EMAIL THIS PAGE TO A FRIEND

TCEAL7

transcription elongation factor A (SII)-like 7

Synonyms: MPMGp800C04260Q003
UniProtKB ID: Q9BRU2, B3KSV2, Q96AT4
Gene ID:
Mouse(100040972) transcription elongation factor A (SII)-like 7
Rat(680319) transcription elongation factor A (SII)-like 7
dog(100682979) transcription elongation factor A (SII)-like 7
domestic cat(101095322) transcription elongation factor A (SII)-like 7
cow(100138330) transcription elongation factor A (SII)-like 7
cow(100139177) transcription elongation factor A (SII)-like 7
sheep(101118167) transcription elongation factor A (SII)-like 7
domestic guinea pig(100715044) transcription elongation factor A (SII)-like 7
naked mole-rat(101704952) transcription elongation factor A (SII)-like 7
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001127169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001127169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001127169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152278 Rosetta Predictions human pricing
NM_001109401 Rosetta Predictions rat pricing
NM_001127169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029218 predicted 358
2 SASI_Hs01_00029219 predicted 255
3 SASI_Hs01_00029220 predicted 489
4 SASI_Hs01_00029221 predicted 275
5 SASI_Hs01_00029222 predicted 244
6 SASI_Hs01_00029223 predicted 324
7 SASI_Hs01_00029224 predicted 470
8 SASI_Hs01_00029226 predicted 334
9 SASI_Hs01_00029227 predicted 291
10 SASI_Hs02_00365816 predicted 481
11 SASI_Hs01_00029225 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248047 predicted 633
2 SASI_Rn02_00248048 predicted 632
3 SASI_Rn02_00248049 predicted 567
4 SASI_Rn02_00248050 predicted 681
5 SASI_Rn02_00248051 predicted 594
6 SASI_Rn02_00248052 predicted 759
7 SASI_Rn02_00248053 predicted 508
8 SASI_Rn02_00248054 predicted 348
9 SASI_Rn02_00248055 predicted 675
10 SASI_Rn02_00248056 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310107 predicted 256
2 SASI_Mm02_00310108 predicted 255
3 SASI_Mm02_00310109 predicted 612
4 SASI_Mm02_00310110 predicted 519
5 SASI_Mm02_00310111 predicted 345
6 SASI_Mm02_00310112 predicted 340
7 SASI_Mm02_00310113 predicted 572
8 SASI_Mm02_00310114 predicted 387
9 SASI_Mm02_00310115 predicted 286
10 SASI_Mm02_00310116 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152278
VALIDATED
TCEAL7 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152278.2-670s21c1
Sequence:CCGGTTGACCCAATCTTATTCATTTCTCGAGAAATGAATAAGATTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-412s21c1
Sequence:CCGGGATGAGATGGAAAGGTGTTTGCTCGAGCAAACACCTTTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-456s21c1
Sequence:CCGGGAAATTTAGGGCTCTGCATTCCTCGAGGAATGCAGAGCCCTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-424s21c1
Sequence:CCGGAGGTGTTTGGAAGAGATAAGGCTCGAGCCTTATCTCTTCCAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-291s21c1
Sequence:CCGGAGAATTTGAACGCCAGCAAACCTCGAGGTTTGCTGGCGTTCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-350s1c1
Sequence:CCGGCGAAGAATTTAAAGAGGACATCTCGAGATGTCCTCTTTAAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-336s1c1
Sequence:CCGGCTGCTTCAGTCTCTCGAAGAACTCGAGTTCTTCGAGAGACTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-471s1c1
Sequence:CCGGCTGCATTCTAACCATAGGCATCTCGAGATGCCTATGGTTAGAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152278.1-830s1c1
Sequence:CCGGGCAAAGGAAAGTGTCTGATTTCTCGAGAAATCAGACACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152278.1-339s1c1
Sequence:CCGGCTTCAGTCTCTCGAAGAATTTCTCGAGAAATTCTTCGAGAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152278
VALIDATED
TCEAL7 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152278.2-670s21c1
Sequence:CCGGTTGACCCAATCTTATTCATTTCTCGAGAAATGAATAAGATTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-412s21c1
Sequence:CCGGGATGAGATGGAAAGGTGTTTGCTCGAGCAAACACCTTTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-456s21c1
Sequence:CCGGGAAATTTAGGGCTCTGCATTCCTCGAGGAATGCAGAGCCCTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-424s21c1
Sequence:CCGGAGGTGTTTGGAAGAGATAAGGCTCGAGCCTTATCTCTTCCAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-291s21c1
Sequence:CCGGAGAATTTGAACGCCAGCAAACCTCGAGGTTTGCTGGCGTTCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-350s1c1
Sequence:CCGGCGAAGAATTTAAAGAGGACATCTCGAGATGTCCTCTTTAAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-336s1c1
Sequence:CCGGCTGCTTCAGTCTCTCGAAGAACTCGAGTTCTTCGAGAGACTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-471s1c1
Sequence:CCGGCTGCATTCTAACCATAGGCATCTCGAGATGCCTATGGTTAGAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152278.1-830s1c1
Sequence:CCGGGCAAAGGAAAGTGTCTGATTTCTCGAGAAATCAGACACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152278.1-339s1c1
Sequence:CCGGCTTCAGTCTCTCGAAGAATTTCTCGAGAAATTCTTCGAGAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152278
VALIDATED
TCEAL7 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152278.2-670s21c1
Sequence:CCGGTTGACCCAATCTTATTCATTTCTCGAGAAATGAATAAGATTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-412s21c1
Sequence:CCGGGATGAGATGGAAAGGTGTTTGCTCGAGCAAACACCTTTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-456s21c1
Sequence:CCGGGAAATTTAGGGCTCTGCATTCCTCGAGGAATGCAGAGCCCTAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-424s21c1
Sequence:CCGGAGGTGTTTGGAAGAGATAAGGCTCGAGCCTTATCTCTTCCAAACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152278.2-291s21c1
Sequence:CCGGAGAATTTGAACGCCAGCAAACCTCGAGGTTTGCTGGCGTTCAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-350s1c1
Sequence:CCGGCGAAGAATTTAAAGAGGACATCTCGAGATGTCCTCTTTAAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-336s1c1
Sequence:CCGGCTGCTTCAGTCTCTCGAAGAACTCGAGTTCTTCGAGAGACTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_152278.1-471s1c1
Sequence:CCGGCTGCATTCTAACCATAGGCATCTCGAGATGCCTATGGTTAGAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152278.1-830s1c1
Sequence:CCGGGCAAAGGAAAGTGTCTGATTTCTCGAGAAATCAGACACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152278.1-339s1c1
Sequence:CCGGCTTCAGTCTCTCGAAGAATTTCTCGAGAAATTCTTCGAGAGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127169
TCEAL7 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-430s21c1
Sequence:CCGGTTAAAGCAGTGGCCTCAGAAACTCGAGTTTCTGAGGCCACTGCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-410s21c1
Sequence:CCGGCATTCTCGGGACCATCCCTTTCTCGAGAAAGGGATGGTCCCGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127169.1-621s21c1
Sequence:CCGGAGACAATCATCTGGTAGTTTACTCGAGTAAACTACCAGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-383s21c1
Sequence:CCGGTTTAGGGCTCTGCATTCTAACCTCGAGGTTAGAATGCAGAGCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-394s21c1
Sequence:CCGGGCATTCTAACCGTACCCATTCCTCGAGGAATGGGTACGGTTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127169
TCEAL7 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-430s21c1
Sequence:CCGGTTAAAGCAGTGGCCTCAGAAACTCGAGTTTCTGAGGCCACTGCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-410s21c1
Sequence:CCGGCATTCTCGGGACCATCCCTTTCTCGAGAAAGGGATGGTCCCGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127169.1-621s21c1
Sequence:CCGGAGACAATCATCTGGTAGTTTACTCGAGTAAACTACCAGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-383s21c1
Sequence:CCGGTTTAGGGCTCTGCATTCTAACCTCGAGGTTAGAATGCAGAGCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-394s21c1
Sequence:CCGGGCATTCTAACCGTACCCATTCCTCGAGGAATGGGTACGGTTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127169
TCEAL7 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-430s21c1
Sequence:CCGGTTAAAGCAGTGGCCTCAGAAACTCGAGTTTCTGAGGCCACTGCTTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-410s21c1
Sequence:CCGGCATTCTCGGGACCATCCCTTTCTCGAGAAAGGGATGGTCCCGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127169.1-621s21c1
Sequence:CCGGAGACAATCATCTGGTAGTTTACTCGAGTAAACTACCAGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-383s21c1
Sequence:CCGGTTTAGGGCTCTGCATTCTAACCTCGAGGTTAGAATGCAGAGCCCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127169.1-394s21c1
Sequence:CCGGGCATTCTAACCGTACCCATTCCTCGAGGAATGGGTACGGTTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks