EMAIL THIS PAGE TO A FRIEND

TCEAL8

transcription elongation factor A (SII)-like 8

UniProtKB ID: Q8IYN2
Gene ID:
Human(90843) Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Mouse(66684) transcription elongation factor A (SII)-like 8
Rat(367909) transcription elongation factor A (SII)-like 8
domestic guinea pig(100712836) transcription elongation factor A (SII)-like 8
cow(768059) transcription elongation factor A (SII)-like 8
sheep(101118673) transcription elongation factor A (SII)-like 8
dog(100688714) transcription elongation factor A (SII)-like 8
domestic cat(101094406) transcription elongation factor A (SII)-like 8
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006684 Rosetta Predictions human pricing
NM_153333 Rosetta Predictions human pricing
NM_001014275 Rosetta Predictions rat pricing
NM_025703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133499 predicted 841
2 SASI_Hs01_00133500 predicted 407
3 SASI_Hs01_00133501 predicted 389
4 SASI_Hs01_00133502 predicted 411
5 SASI_Hs01_00133503 predicted 312
6 SASI_Hs01_00133504 predicted 213
7 SASI_Hs01_00133505 predicted 857
8 SASI_Hs01_00133507 predicted 247
9 SASI_Hs01_00133508 predicted 396
10 SASI_Hs02_00305134 predicted 226
11 SASI_Hs01_00133506 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218982 predicted 480
2 SASI_Hs01_00218983 predicted 460
3 SASI_Hs01_00218985 predicted 478
4 SASI_Hs01_00218986 predicted 379
5 SASI_Hs01_00218987 predicted 292
6 SASI_Hs01_00218988 predicted 320
7 SASI_Hs01_00218989 predicted 471
8 SASI_Hs01_00218990 predicted 297
9 SASI_Hs01_00218991 predicted 401
10 SASI_Hs02_00367184 predicted 1109
11 SASI_Hs01_00218984 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103790 predicted 279
2 SASI_Rn01_00103791 predicted 527
3 SASI_Rn01_00103792 predicted 382
4 SASI_Rn01_00103793 predicted 362
5 SASI_Rn01_00103794 predicted 439
6 SASI_Rn01_00103795 predicted 529
7 SASI_Rn01_00103796 predicted 454
8 SASI_Rn01_00103797 predicted 325
9 SASI_Rn01_00103798 predicted 245
10 SASI_Rn01_00103799 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153408 predicted 223
2 SASI_Mm01_00153409 predicted 222
3 SASI_Mm01_00153410 predicted 250
4 SASI_Mm01_00153411 predicted 258
5 SASI_Mm01_00153412 predicted 223
6 SASI_Mm01_00153414 predicted 226
7 SASI_Mm01_00153415 predicted 219
8 SASI_Mm01_00153416 predicted 255
9 SASI_Mm01_00153417 predicted 290
10 SASI_Mm02_00328872 predicted 230
11 SASI_Mm01_00153413 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153333
VALIDATED
TCEAL8 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-485s1c1
Sequence:CCGGGAGCTTGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-458s1c1
Sequence:CCGGCCTGAAGAAATGATAAGAGGACTCGAGTCCTCTTATCATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.2-640s1c1
Sequence:CCGGGATGTATCTTTGACCTCCATTCTCGAGAATGGAGGTCAAAGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-342s1c1
Sequence:CCGGGAAATCCTCAACCTTCCGAAGCTCGAGCTTCGGAAGGTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-541s21c1
Sequence:CCGGATTCACGCAGCCGTCCTTATCCTCGAGGATAAGGACGGCTGCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153333.2-935s21c1
Sequence:CCGGCAAACTTAACCAAGCTTATTTCTCGAGAAATAAGCTTGGTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-288s21c1
Sequence:CCGGGATCGCCCTTTGGAGGATGTACTCGAGTACATCCTCCAAAGGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-508s21c1
Sequence:CCGGACAAGTTTGTGATGATGCATTCTCGAGAATGCATCATCACAAACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-403s21c1
Sequence:CCGGAGGGATTTAAAGAGGACACACCTCGAGGTGTGTCCTCTTTAAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153333
VALIDATED
TCEAL8 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-485s1c1
Sequence:CCGGGAGCTTGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-458s1c1
Sequence:CCGGCCTGAAGAAATGATAAGAGGACTCGAGTCCTCTTATCATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.2-640s1c1
Sequence:CCGGGATGTATCTTTGACCTCCATTCTCGAGAATGGAGGTCAAAGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-342s1c1
Sequence:CCGGGAAATCCTCAACCTTCCGAAGCTCGAGCTTCGGAAGGTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-541s21c1
Sequence:CCGGATTCACGCAGCCGTCCTTATCCTCGAGGATAAGGACGGCTGCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153333.2-935s21c1
Sequence:CCGGCAAACTTAACCAAGCTTATTTCTCGAGAAATAAGCTTGGTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-288s21c1
Sequence:CCGGGATCGCCCTTTGGAGGATGTACTCGAGTACATCCTCCAAAGGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-508s21c1
Sequence:CCGGACAAGTTTGTGATGATGCATTCTCGAGAATGCATCATCACAAACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-403s21c1
Sequence:CCGGAGGGATTTAAAGAGGACACACCTCGAGGTGTGTCCTCTTTAAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153333
VALIDATED
TCEAL8 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-485s1c1
Sequence:CCGGGAGCTTGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-458s1c1
Sequence:CCGGCCTGAAGAAATGATAAGAGGACTCGAGTCCTCTTATCATTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.2-640s1c1
Sequence:CCGGGATGTATCTTTGACCTCCATTCTCGAGAATGGAGGTCAAAGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153333.1-342s1c1
Sequence:CCGGGAAATCCTCAACCTTCCGAAGCTCGAGCTTCGGAAGGTTGAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-541s21c1
Sequence:CCGGATTCACGCAGCCGTCCTTATCCTCGAGGATAAGGACGGCTGCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153333.2-935s21c1
Sequence:CCGGCAAACTTAACCAAGCTTATTTCTCGAGAAATAAGCTTGGTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-288s21c1
Sequence:CCGGGATCGCCCTTTGGAGGATGTACTCGAGTACATCCTCCAAAGGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-508s21c1
Sequence:CCGGACAAGTTTGTGATGATGCATTCTCGAGAATGCATCATCACAAACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153333.2-403s21c1
Sequence:CCGGAGGGATTTAAAGAGGACACACCTCGAGGTGTGTCCTCTTTAAATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025703
VALIDATED
TCEAL8 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-564s1c1
Sequence:CCGGGCTTTCTTTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-412s1c1
Sequence:CCGGGAGTTGGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-495s1c1
Sequence:CCGGCCGTCCTTACCCTGTGTGCTTCTCGAGAAGCACACAGGGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-444s1c1
Sequence:CCGGAGTAAGAAACAAGTTCGTGTTCTCGAGAACACGAACTTGTTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-391s1c1
Sequence:CCGGGAAGTGATAAGAGGCGTAGATCTCGAGATCTACGCCTCTTATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025703
VALIDATED
TCEAL8 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-564s1c1
Sequence:CCGGGCTTTCTTTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-412s1c1
Sequence:CCGGGAGTTGGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-495s1c1
Sequence:CCGGCCGTCCTTACCCTGTGTGCTTCTCGAGAAGCACACAGGGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-444s1c1
Sequence:CCGGAGTAAGAAACAAGTTCGTGTTCTCGAGAACACGAACTTGTTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-391s1c1
Sequence:CCGGGAAGTGATAAGAGGCGTAGATCTCGAGATCTACGCCTCTTATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025703
VALIDATED
TCEAL8 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-564s1c1
Sequence:CCGGGCTTTCTTTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-412s1c1
Sequence:CCGGGAGTTGGAAAGGCTTAGGGAACTCGAGTTCCCTAAGCCTTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025703.2-495s1c1
Sequence:CCGGCCGTCCTTACCCTGTGTGCTTCTCGAGAAGCACACAGGGTAAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-444s1c1
Sequence:CCGGAGTAAGAAACAAGTTCGTGTTCTCGAGAACACGAACTTGTTTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025703.2-391s1c1
Sequence:CCGGGAAGTGATAAGAGGCGTAGATCTCGAGATCTACGCCTCTTATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks