EMAIL THIS PAGE TO A FRIEND

TCEANC2

transcription elongation factor A (SII) N-terminal and central domain containing 2

Synonyms: C1orf83 RP4-758J24.3
UniProtKB ID: Q96MN5, Q5T702, Q8N8N2
Gene ID:
Mouse(66526) transcription elongation factor A (SII) N-terminal and central domain containing 2
Rat(366431) transcription elongation factor A (SII) N-terminal and central domain containing 2
naked mole-rat(101701533) transcription elongation factor A (SII) N-terminal and central domain containing 2
domestic guinea pig(100714548) transcription elongation factor A (SII) N-terminal and central domain containing 2
cow(539385) transcription elongation factor A (SII) N-terminal and central domain containing 2
sheep(101121382) transcription elongation factor A (SII) N-terminal and central domain containing 2
Zebrafish(567698) transcription elongation factor A (SII) N-terminal and central domain containing 2
domestic cat(101096499) transcription elongation factor A (SII) N-terminal and central domain containing 2
dog(610613) transcription elongation factor A (SII) N-terminal and central domain containing 2
chicken(424657) transcription elongation factor A (SII) N-terminal and central domain containing 2
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153035 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024021 MISSION® esiRNA esiRNA human C1orf83 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153035 Rosetta Predictions human pricing
NM_001014260 Rosetta Predictions rat pricing
NM_025617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031109 predicted 297
2 SASI_Hs01_00031110 predicted 541
3 SASI_Hs01_00031111 predicted 897
4 SASI_Hs01_00031112 predicted 361
5 SASI_Hs01_00031113 predicted 460
6 SASI_Hs01_00031114 predicted 734
7 SASI_Hs01_00031115 predicted 550
8 SASI_Hs01_00031116 predicted 239
9 SASI_Hs01_00031118 predicted 429
10 SASI_Hs02_00366989 predicted 232
11 SASI_Hs01_00031117 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113138 predicted 481
2 SASI_Rn01_00113139 predicted 1231
3 SASI_Rn01_00113140 predicted 816
4 SASI_Rn01_00113141 predicted 567
5 SASI_Rn01_00113142 predicted 231
6 SASI_Rn01_00113144 predicted 423
7 SASI_Rn01_00113145 predicted 1087
8 SASI_Rn01_00113146 predicted 1237
9 SASI_Rn02_00201829 predicted 210
10 SASI_Rn01_00113147 predicted 474
11 SASI_Rn01_00113143 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030090 predicted 842
2 SASI_Mm01_00030091 predicted 259
3 SASI_Mm02_00328656 predicted 389
4 SASI_Mm01_00030092 predicted 1284
5 SASI_Mm01_00030093 predicted 500
6 SASI_Mm01_00030094 predicted 463
7 SASI_Mm01_00030095 predicted 1098
8 SASI_Mm02_00328657 predicted 208
9 SASI_Mm01_00030097 predicted 604
10 SASI_Mm01_00030098 predicted 521
11 SASI_Mm01_00030096 predicted 291
12 SASI_Mm01_00030099 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025617
VALIDATED
TCEANC2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII) N-terminal and central domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-779s1c1
Sequence:CCGGGCCACCATTCAAAGCCTCTTTCTCGAGAAAGAGGCTTTGAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-302s1c1
Sequence:CCGGTGCTGCCTTACAAGAATTAAACTCGAGTTTAATTCTTGTAAGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025617.1-168s1c1
Sequence:CCGGCCGAAGAAGAAACTCGGAGAACTCGAGTTCTCCGAGTTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-650s1c1
Sequence:CCGGCGCTCTGGTCTTCACATTAAACTCGAGTTTAATGTGAAGACCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-530s1c1
Sequence:CCGGGAAATTACTTTCAGAAGCCTTCTCGAGAAGGCTTCTGAAAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-649s21c1
Sequence:CCGGATCTCTGCTCCCGGCTCATTACTCGAGTAATGAGCCGGGAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-264s21c1
Sequence:CCGGTTGAAGAGAGTTGTGGTTATACTCGAGTATAACCACAACTCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-311s21c1
Sequence:CCGGGTTGGAGCTTCCTGATCAAACCTCGAGGTTTGATCAGGAAGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-693s21c1
Sequence:CCGGCGCGCTCTGGTCTTCACATTACTCGAGTAATGTGAAGACCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025617.2-865s21c1
Sequence:CCGGTGTTGGCTGTGCTGGATATTCCTCGAGGAATATCCAGCACAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025617
VALIDATED
TCEANC2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII) N-terminal and central domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-779s1c1
Sequence:CCGGGCCACCATTCAAAGCCTCTTTCTCGAGAAAGAGGCTTTGAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-302s1c1
Sequence:CCGGTGCTGCCTTACAAGAATTAAACTCGAGTTTAATTCTTGTAAGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025617.1-168s1c1
Sequence:CCGGCCGAAGAAGAAACTCGGAGAACTCGAGTTCTCCGAGTTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-650s1c1
Sequence:CCGGCGCTCTGGTCTTCACATTAAACTCGAGTTTAATGTGAAGACCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-530s1c1
Sequence:CCGGGAAATTACTTTCAGAAGCCTTCTCGAGAAGGCTTCTGAAAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-649s21c1
Sequence:CCGGATCTCTGCTCCCGGCTCATTACTCGAGTAATGAGCCGGGAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-264s21c1
Sequence:CCGGTTGAAGAGAGTTGTGGTTATACTCGAGTATAACCACAACTCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-311s21c1
Sequence:CCGGGTTGGAGCTTCCTGATCAAACCTCGAGGTTTGATCAGGAAGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-693s21c1
Sequence:CCGGCGCGCTCTGGTCTTCACATTACTCGAGTAATGTGAAGACCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025617.2-865s21c1
Sequence:CCGGTGTTGGCTGTGCTGGATATTCCTCGAGGAATATCCAGCACAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025617
VALIDATED
TCEANC2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII) N-terminal and central domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-779s1c1
Sequence:CCGGGCCACCATTCAAAGCCTCTTTCTCGAGAAAGAGGCTTTGAATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-302s1c1
Sequence:CCGGTGCTGCCTTACAAGAATTAAACTCGAGTTTAATTCTTGTAAGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025617.1-168s1c1
Sequence:CCGGCCGAAGAAGAAACTCGGAGAACTCGAGTTCTCCGAGTTTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-650s1c1
Sequence:CCGGCGCTCTGGTCTTCACATTAAACTCGAGTTTAATGTGAAGACCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025617.1-530s1c1
Sequence:CCGGGAAATTACTTTCAGAAGCCTTCTCGAGAAGGCTTCTGAAAGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-649s21c1
Sequence:CCGGATCTCTGCTCCCGGCTCATTACTCGAGTAATGAGCCGGGAGCAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-264s21c1
Sequence:CCGGTTGAAGAGAGTTGTGGTTATACTCGAGTATAACCACAACTCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-311s21c1
Sequence:CCGGGTTGGAGCTTCCTGATCAAACCTCGAGGTTTGATCAGGAAGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025617.2-693s21c1
Sequence:CCGGCGCGCTCTGGTCTTCACATTACTCGAGTAATGTGAAGACCAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025617.2-865s21c1
Sequence:CCGGTGTTGGCTGTGCTGGATATTCCTCGAGGAATATCCAGCACAGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153035
VALIDATED
TCEANC2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII) N-terminal and central domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-603s1c1
Sequence:CCGGGCTCAGAAATTACTCTCAGAACTCGAGTTCTGAGAGTAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-465s1c1
Sequence:CCGGCGTAAACACTCAGATTCAGAACTCGAGTTCTGAATCTGAGTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-369s1c1
Sequence:CCGGGAGAATCTTGTTGAAGCCTTACTCGAGTAAGGCTTCAACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153035.1-375s1c1
Sequence:CCGGCTTGTTGAAGCCTTACAAGAACTCGAGTTCTTGTAAGGCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153035.1-2370s1c1
Sequence:CCGGCCGGGTCTATTTGATTGTATACTCGAGTATACAATCAAATAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153035.1-248s1c1
Sequence:CCGGGAAGAAAGATTCTGGAGGAAACTCGAGTTTCCTCCAGAATCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-275s21c1
Sequence:CCGGCAAGCAGGCCACGATTGAATCCTCGAGGATTCAATCGTGGCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-661s21c1
Sequence:CCGGATATTGAACGGGAAACGTTTCCTCGAGGAAACGTTTCCCGTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-555s21c1
Sequence:CCGGTCTATTGAAGTTAGAAGTGATCTCGAGATCACTTCTAACTTCAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-800s21c1
Sequence:CCGGCACGTTTGTACAGACCCACAACTCGAGTTGTGGGTCTGTACAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-724s21c1
Sequence:CCGGTGAGAGCCCTGGTCTTCACATCTCGAGATGTGAAGACCAGGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-639s21c1
Sequence:CCGGATGGATCACCTACTGGTTGAACTCGAGTTCAACCAGTAGGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153035
VALIDATED
TCEANC2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII) N-terminal and central domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-603s1c1
Sequence:CCGGGCTCAGAAATTACTCTCAGAACTCGAGTTCTGAGAGTAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-465s1c1
Sequence:CCGGCGTAAACACTCAGATTCAGAACTCGAGTTCTGAATCTGAGTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-369s1c1
Sequence:CCGGGAGAATCTTGTTGAAGCCTTACTCGAGTAAGGCTTCAACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153035.1-375s1c1
Sequence:CCGGCTTGTTGAAGCCTTACAAGAACTCGAGTTCTTGTAAGGCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153035.1-2370s1c1
Sequence:CCGGCCGGGTCTATTTGATTGTATACTCGAGTATACAATCAAATAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153035.1-248s1c1
Sequence:CCGGGAAGAAAGATTCTGGAGGAAACTCGAGTTTCCTCCAGAATCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-275s21c1
Sequence:CCGGCAAGCAGGCCACGATTGAATCCTCGAGGATTCAATCGTGGCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-661s21c1
Sequence:CCGGATATTGAACGGGAAACGTTTCCTCGAGGAAACGTTTCCCGTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-555s21c1
Sequence:CCGGTCTATTGAAGTTAGAAGTGATCTCGAGATCACTTCTAACTTCAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-800s21c1
Sequence:CCGGCACGTTTGTACAGACCCACAACTCGAGTTGTGGGTCTGTACAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-724s21c1
Sequence:CCGGTGAGAGCCCTGGTCTTCACATCTCGAGATGTGAAGACCAGGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-639s21c1
Sequence:CCGGATGGATCACCTACTGGTTGAACTCGAGTTCAACCAGTAGGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153035
VALIDATED
TCEANC2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII) N-terminal and central domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-603s1c1
Sequence:CCGGGCTCAGAAATTACTCTCAGAACTCGAGTTCTGAGAGTAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-465s1c1
Sequence:CCGGCGTAAACACTCAGATTCAGAACTCGAGTTCTGAATCTGAGTGTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153035.1-369s1c1
Sequence:CCGGGAGAATCTTGTTGAAGCCTTACTCGAGTAAGGCTTCAACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153035.1-375s1c1
Sequence:CCGGCTTGTTGAAGCCTTACAAGAACTCGAGTTCTTGTAAGGCTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153035.1-2370s1c1
Sequence:CCGGCCGGGTCTATTTGATTGTATACTCGAGTATACAATCAAATAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153035.1-248s1c1
Sequence:CCGGGAAGAAAGATTCTGGAGGAAACTCGAGTTTCCTCCAGAATCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-275s21c1
Sequence:CCGGCAAGCAGGCCACGATTGAATCCTCGAGGATTCAATCGTGGCCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-661s21c1
Sequence:CCGGATATTGAACGGGAAACGTTTCCTCGAGGAAACGTTTCCCGTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-555s21c1
Sequence:CCGGTCTATTGAAGTTAGAAGTGATCTCGAGATCACTTCTAACTTCAATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-800s21c1
Sequence:CCGGCACGTTTGTACAGACCCACAACTCGAGTTGTGGGTCTGTACAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-724s21c1
Sequence:CCGGTGAGAGCCCTGGTCTTCACATCTCGAGATGTGAAGACCAGGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153035.1-639s21c1
Sequence:CCGGATGGATCACCTACTGGTTGAACTCGAGTTCAACCAGTAGGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks