EMAIL THIS PAGE TO A FRIEND

TCEANC

transcription elongation factor A (SII) N-terminal and central domain containing

UniProtKB ID: Q8N8B7, A6NI06, B2RDM3
Gene ID:
Mouse(245695) transcription elongation factor A (SII) N-terminal and central domain containing
Rat(367782) transcription elongation factor A (SII) N-terminal and central domain containing
chicken(418636) transcription elongation factor A (SII) N-terminal and central domain containing
domestic cat(101092743) transcription elongation factor A (SII) N-terminal and central domain containing
dog(480839) transcription elongation factor A (SII) N-terminal and central domain containing
cow(504389) transcription elongation factor A (SII) N-terminal and central domain containing
domestic guinea pig(100717711) transcription elongation factor A (SII) N-terminal and central domain containing
naked mole-rat(101723969) transcription elongation factor A (SII) N-terminal and central domain containing
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152634 Rosetta Predictions human pricing
XM_372198 Rosetta Predictions human pricing
XM_933483 Rosetta Predictions human pricing
NM_001109015 Rosetta Predictions rat pricing
NM_001007577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366501 predicted 899
2 SASI_Hs02_00366502 predicted 863
3 SASI_Hs02_00366503 predicted 876
4 SASI_Hs02_00366504 predicted 1189
5 SASI_Hs02_00366505 predicted 1006
6 SASI_Hs02_00366506 predicted 1127
7 SASI_Hs02_00366507 predicted 1011
8 SASI_Hs02_00366508 predicted 858
9 SASI_Hs02_00366509 predicted 641
10 SASI_Hs02_00366510 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266951 predicted 211
2 SASI_Hs01_00266952 predicted 622
3 SASI_Hs01_00266953 predicted 670
4 SASI_Hs01_00266954 predicted 677
5 SASI_Hs01_00266955 predicted 662
6 SASI_Hs01_00266956 predicted 780
7 SASI_Hs01_00266957 predicted 918
8 SASI_Hs01_00266958 predicted 646
9 SASI_Hs01_00266959 predicted 535
10 SASI_Hs01_00266960 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291423 predicted 219
2 SASI_Hs01_00291424 predicted 678
3 SASI_Hs01_00291425 predicted 656
4 SASI_Hs01_00291426 predicted 741
5 SASI_Hs01_00291427 predicted 966
6 SASI_Hs01_00291428 predicted 786
7 SASI_Hs01_00291429 predicted 918
8 SASI_Hs01_00291430 predicted 792
9 SASI_Hs01_00291431 predicted 640
10 SASI_Hs01_00291432 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244334 predicted 524
2 SASI_Rn02_00244335 predicted 546
3 SASI_Rn02_00244336 predicted 473
4 SASI_Rn02_00244337 predicted 620
5 SASI_Rn02_00244338 predicted 224
6 SASI_Rn02_00244339 predicted 283
7 SASI_Rn02_00244340 predicted 786
8 SASI_Rn02_00244341 predicted 690
9 SASI_Rn02_00244342 predicted 647
10 SASI_Rn02_00244343 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080119 predicted 1240
2 SASI_Mm01_00080120 predicted 816
3 SASI_Mm01_00080121 predicted 780
4 SASI_Mm01_00080122 predicted 728
5 SASI_Mm01_00080123 predicted 610
6 SASI_Mm01_00080124 predicted 1068
7 SASI_Mm01_00080125 predicted 883
8 SASI_Mm01_00080126 predicted 1073
9 SASI_Mm01_00080128 predicted 527
10 SASI_Mm02_00286758 predicted 1021
11 SASI_Mm01_00080127 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152634
TCEANC MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII) N-terminal and central domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152634.2-1562s21c1
Sequence:CCGGGAGGGAGTGGATGACTATTTACTCGAGTAAATAGTCATCCACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-590s21c1
Sequence:CCGGAGCGAGGAACAGCCCTAAATTCTCGAGAATTTAGGGCTGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-1320s21c1
Sequence:CCGGCAAATGATGACTTACGTAATTCTCGAGAATTACGTAAGTCATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-844s21c1
Sequence:GTACCGGCAACACCCATGAGAACTAAATCTCGAGATTTAGTTCTCATGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-537s21c1
Sequence:CCGGGCCAAGTGTTTGCTATCAAAGCTCGAGCTTTGATAGCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152634
TCEANC MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII) N-terminal and central domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152634.2-1562s21c1
Sequence:CCGGGAGGGAGTGGATGACTATTTACTCGAGTAAATAGTCATCCACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-590s21c1
Sequence:CCGGAGCGAGGAACAGCCCTAAATTCTCGAGAATTTAGGGCTGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-1320s21c1
Sequence:CCGGCAAATGATGACTTACGTAATTCTCGAGAATTACGTAAGTCATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-844s21c1
Sequence:GTACCGGCAACACCCATGAGAACTAAATCTCGAGATTTAGTTCTCATGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-537s21c1
Sequence:CCGGGCCAAGTGTTTGCTATCAAAGCTCGAGCTTTGATAGCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152634
TCEANC MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII) N-terminal and central domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152634.2-1562s21c1
Sequence:CCGGGAGGGAGTGGATGACTATTTACTCGAGTAAATAGTCATCCACTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-590s21c1
Sequence:CCGGAGCGAGGAACAGCCCTAAATTCTCGAGAATTTAGGGCTGTTCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-1320s21c1
Sequence:CCGGCAAATGATGACTTACGTAATTCTCGAGAATTACGTAAGTCATCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-844s21c1
Sequence:GTACCGGCAACACCCATGAGAACTAAATCTCGAGATTTAGTTCTCATGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152634.2-537s21c1
Sequence:CCGGGCCAAGTGTTTGCTATCAAAGCTCGAGCTTTGATAGCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007577
TCEANC MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII) N-terminal and central domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007577.1-2249s1c1
Sequence:CCGGGCCAAGCCTATACAGTTCAATCTCGAGATTGAACTGTATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-1341s1c1
Sequence:CCGGCCCAATCAGTTGATGGCACATCTCGAGATGTGCCATCAACTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-615s1c1
Sequence:CCGGGCTGTTTACAGAGTCCTCAAACTCGAGTTTGAGGACTCTGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-535s1c1
Sequence:CCGGAGGATATTGGTAAACAGCTTACTCGAGTAAGCTGTTTACCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-730s1c1
Sequence:CCGGGCCCTAAAGTACTCCACACAACTCGAGTTGTGTGGAGTACTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007577
TCEANC MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII) N-terminal and central domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007577.1-2249s1c1
Sequence:CCGGGCCAAGCCTATACAGTTCAATCTCGAGATTGAACTGTATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-1341s1c1
Sequence:CCGGCCCAATCAGTTGATGGCACATCTCGAGATGTGCCATCAACTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-615s1c1
Sequence:CCGGGCTGTTTACAGAGTCCTCAAACTCGAGTTTGAGGACTCTGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-535s1c1
Sequence:CCGGAGGATATTGGTAAACAGCTTACTCGAGTAAGCTGTTTACCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-730s1c1
Sequence:CCGGGCCCTAAAGTACTCCACACAACTCGAGTTGTGTGGAGTACTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007577
TCEANC MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII) N-terminal and central domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007577.1-2249s1c1
Sequence:CCGGGCCAAGCCTATACAGTTCAATCTCGAGATTGAACTGTATAGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-1341s1c1
Sequence:CCGGCCCAATCAGTTGATGGCACATCTCGAGATGTGCCATCAACTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-615s1c1
Sequence:CCGGGCTGTTTACAGAGTCCTCAAACTCGAGTTTGAGGACTCTGTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-535s1c1
Sequence:CCGGAGGATATTGGTAAACAGCTTACTCGAGTAAGCTGTTTACCAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007577.1-730s1c1
Sequence:CCGGGCCCTAAAGTACTCCACACAACTCGAGTTGTGTGGAGTACTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks