EMAIL THIS PAGE TO A FRIEND

TCEB1

transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)

Synonyms: SIII eloC
UniProtKB ID: Q15369, E5RGD9, Q567Q6
Gene ID:
Human(6921) Summary: This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Mouse(67923) transcription elongation factor B (SIII), polypeptide 1
Rat(64525) transcription elongation factor B (SIII), polypeptide 1
chicken(420187) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
domestic cat(100628309) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
dog(477914) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
cow(540859) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
sheep(101107798) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
domestic guinea pig(100729701) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
naked mole-rat(101723674) transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005648 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146431 MISSION® esiRNA esiRNA targeting mouse Tceb1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005648 Rosetta Predictions human pricing
NM_022593 Rosetta Predictions rat pricing
NM_026456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205654 predicted 145
2 SASI_Hs01_00205645 predicted 468
3 SASI_Hs01_00205647 predicted 468
4 SASI_Hs02_00340006 predicted 183
5 SASI_Hs02_00340007 predicted 121
6 SASI_Hs01_00205648 predicted 499
7 SASI_Hs01_00205649 predicted 507
8 SASI_Hs02_00340008 predicted 349
9 SASI_Hs02_00340009 predicted 181
10 SASI_Hs01_00205650 predicted 250
11 SASI_Hs01_00205646 predicted 283
12 SASI_Hs01_00205651 predicted 514
13 SASI_Hs01_00205652 predicted 285
14 SASI_Hs01_00205653 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037808 predicted 170
2 SASI_Rn02_00263338 predicted 120
3 SASI_Rn01_00037809 predicted 357
4 SASI_Rn02_00263339 predicted 85
5 SASI_Rn01_00037814 predicted 217
6 SASI_Rn01_00037815 predicted 238
7 SASI_Rn02_00263340 predicted 79
8 SASI_Rn02_00263341 predicted 366
9 SASI_Rn02_00263342 predicted 230
10 SASI_Rn02_00263343 predicted 252
11 SASI_Rn01_00037810 predicted 563
12 SASI_Rn01_00037811 predicted 528
13 SASI_Rn01_00037812 predicted 495
14 SASI_Rn01_00037813 predicted 566
15 SASI_Rn01_00037816 predicted 201
16 SASI_Rn01_00037817 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069269 predicted 723
2 SASI_Mm01_00069270 predicted 503
3 SASI_Mm02_00330309 predicted 708
4 SASI_Mm01_00069271 predicted 616
5 SASI_Mm02_00330310 predicted 712
6 SASI_Mm01_00069273 predicted 234
7 SASI_Mm02_00330311 predicted 509
8 SASI_Mm01_00069277 predicted 514
9 SASI_Mm02_00330312 predicted 670
10 SASI_Mm02_00330313 predicted 499
11 SASI_Mm01_00069268 predicted 908
12 SASI_Mm01_00069272 predicted 819
13 SASI_Mm01_00069274 predicted 909
14 SASI_Mm01_00069275 predicted 560
15 SASI_Mm01_00069276 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026456
VALIDATED
TCEB1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-132s21c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-238s21c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-199s21c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-409s21c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-133s1c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026456.2-1259s1c1
Sequence:CCGGCCTGCATTACAGGAATGCTATCTCGAGATAGCATTCCTGTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-239s1c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-200s1c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-410s1c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026456
VALIDATED
TCEB1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-132s21c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-238s21c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-199s21c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-409s21c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-133s1c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026456.2-1259s1c1
Sequence:CCGGCCTGCATTACAGGAATGCTATCTCGAGATAGCATTCCTGTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-239s1c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-200s1c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-410s1c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026456
VALIDATED
TCEB1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-132s21c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-238s21c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-199s21c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026456.4-409s21c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-133s1c1
Sequence:CCGGCCCTGATGCTATGTATGTGAACTCGAGTTCACATACATAGCATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026456.2-1259s1c1
Sequence:CCGGCCTGCATTACAGGAATGCTATCTCGAGATAGCATTCCTGTAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-239s1c1
Sequence:CCGGCCAGGTCAGTTTGCTGAGAATCTCGAGATTCTCAGCAAACTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-200s1c1
Sequence:CCGGGCACTAACATCAGGAACAATACTCGAGTATTGTTCCTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026456.2-410s1c1
Sequence:CCGGGCTGCAAACTTCCTAGATTGTCTCGAGACAATCTAGGAAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005648
TCEB1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-290s21c1
Sequence:CCGGGTGCTATCGAAAGTATGCATGCTCGAGCATGCATACTTTCGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005648.2-470s21c1
Sequence:GTACCGGACCTGTAGTTCAGTTAGTAACCTCGAGGTTACTAACTGAACTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-126s21c1
Sequence:GTACCGGCTGATGCCATGTATGTCAAATCTCGAGATTTGACATACATGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-316s21c1
Sequence:CCGGTACGTACAAGGTTCGCTACACCTCGAGGTGTAGCGAACCTTGTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-235s21c1
Sequence:CCGGTCAGTTTGCTGAGAACGAAACCTCGAGGTTTCGTTCTCAGCAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005648.2-472s1c1
Sequence:CCGGCTGTAGTTCAGTTAGTAACTTCTCGAGAAGTTACTAACTGAACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-250s1c1
Sequence:CCGGCGAAACCAATGAGGTCAATTTCTCGAGAAATTGACCTCATTGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-318s1c1
Sequence:CCGGCGTACAAGGTTCGCTACACTACTCGAGTAGTGTAGCGAACCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-131s1c1
Sequence:CCGGGCCATGTATGTCAAATTGATACTCGAGTATCAATTTGACATACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-371s1c1
Sequence:CCGGGCACCTGAAATTGCACTGGAACTCGAGTTCCAGTGCAATTTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005648
TCEB1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-290s21c1
Sequence:CCGGGTGCTATCGAAAGTATGCATGCTCGAGCATGCATACTTTCGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005648.2-470s21c1
Sequence:GTACCGGACCTGTAGTTCAGTTAGTAACCTCGAGGTTACTAACTGAACTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-126s21c1
Sequence:GTACCGGCTGATGCCATGTATGTCAAATCTCGAGATTTGACATACATGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-316s21c1
Sequence:CCGGTACGTACAAGGTTCGCTACACCTCGAGGTGTAGCGAACCTTGTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-235s21c1
Sequence:CCGGTCAGTTTGCTGAGAACGAAACCTCGAGGTTTCGTTCTCAGCAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005648.2-472s1c1
Sequence:CCGGCTGTAGTTCAGTTAGTAACTTCTCGAGAAGTTACTAACTGAACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-250s1c1
Sequence:CCGGCGAAACCAATGAGGTCAATTTCTCGAGAAATTGACCTCATTGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-318s1c1
Sequence:CCGGCGTACAAGGTTCGCTACACTACTCGAGTAGTGTAGCGAACCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-131s1c1
Sequence:CCGGGCCATGTATGTCAAATTGATACTCGAGTATCAATTTGACATACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-371s1c1
Sequence:CCGGGCACCTGAAATTGCACTGGAACTCGAGTTCCAGTGCAATTTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005648
TCEB1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-290s21c1
Sequence:CCGGGTGCTATCGAAAGTATGCATGCTCGAGCATGCATACTTTCGATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005648.2-470s21c1
Sequence:GTACCGGACCTGTAGTTCAGTTAGTAACCTCGAGGTTACTAACTGAACTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-126s21c1
Sequence:GTACCGGCTGATGCCATGTATGTCAAATCTCGAGATTTGACATACATGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-316s21c1
Sequence:CCGGTACGTACAAGGTTCGCTACACCTCGAGGTGTAGCGAACCTTGTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005648.2-235s21c1
Sequence:CCGGTCAGTTTGCTGAGAACGAAACCTCGAGGTTTCGTTCTCAGCAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005648.2-472s1c1
Sequence:CCGGCTGTAGTTCAGTTAGTAACTTCTCGAGAAGTTACTAACTGAACTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-250s1c1
Sequence:CCGGCGAAACCAATGAGGTCAATTTCTCGAGAAATTGACCTCATTGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-318s1c1
Sequence:CCGGCGTACAAGGTTCGCTACACTACTCGAGTAGTGTAGCGAACCTTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-131s1c1
Sequence:CCGGGCCATGTATGTCAAATTGATACTCGAGTATCAATTTGACATACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005648.2-371s1c1
Sequence:CCGGGCACCTGAAATTGCACTGGAACTCGAGTTCCAGTGCAATTTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks