EMAIL THIS PAGE TO A FRIEND

TCEB2

transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)

Synonyms: ELOB SIII
UniProtKB ID: Q15370, B7WPD3
Gene ID:
Human(6923) Summary: This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]
Mouse(67673) transcription elongation factor B (SIII), polypeptide 2
Rat(81807) transcription elongation factor B (SIII), polypeptide 2
Zebrafish(192341) transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B)
domestic cat(100628310) transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
dog(479873) transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
cow(617277) transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Goat(100861051) transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
domestic guinea pig(100713146) transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007108 Rosetta Predictions human pricing
NM_207013 Rosetta Predictions human pricing
NM_031129 Rosetta Predictions rat pricing
NM_026305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184724 predicted 300
2 SASI_Hs01_00184725 predicted 741
3 SASI_Hs01_00184726 predicted 755
4 SASI_Hs01_00184728 predicted 699
5 SASI_Hs01_00184730 predicted 202
6 SASI_Hs01_00184731 predicted 338
7 SASI_Hs02_00342948 predicted 694
8 SASI_Hs02_00342949 predicted 557
9 SASI_Hs02_00342950 predicted 240
10 SASI_Hs02_00342951 predicted 739
11 SASI_Hs01_00184722 predicted 569
12 SASI_Hs01_00184723 predicted 546
13 SASI_Hs01_00184727 predicted 381
14 SASI_Hs01_00184729 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024144 predicted 307
2 SASI_Hs02_00373705 predicted 301
3 SASI_Hs01_00024145 predicted 377
4 SASI_Hs01_00024147 predicted 291
5 SASI_Hs01_00024149 predicted 205
6 SASI_Hs02_00373706 predicted 337
7 SASI_Hs01_00024150 predicted 341
8 SASI_Hs01_00024151 predicted 377
9 SASI_Hs01_00024152 predicted 236
10 SASI_Hs01_00024153 predicted 332
11 SASI_Hs01_00024146 predicted 385
12 SASI_Hs01_00024148 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264442 predicted 206
2 SASI_Rn02_00264443 predicted 208
3 SASI_Rn02_00264444 predicted 209
4 SASI_Rn02_00264445 predicted 215
5 SASI_Rn02_00264446 predicted 285
6 SASI_Rn02_00264447 predicted 327
7 SASI_Rn02_00264448 predicted 69
8 SASI_Rn02_00264449 predicted 287
9 SASI_Rn02_00264450 predicted 56
10 SASI_Rn02_00264451 predicted 111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137509 predicted 449
2 SASI_Mm01_00137510 predicted 29
3 SASI_Mm01_00137511 predicted 55
4 SASI_Mm01_00137512 predicted 457
5 SASI_Mm01_00137513 predicted 109
6 SASI_Mm01_00137514 predicted 46
7 SASI_Mm01_00137515 predicted 334
8 SASI_Mm01_00137516 predicted 137
9 SASI_Mm01_00137517 predicted 373
10 SASI_Mm01_00137518 predicted 151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026305
VALIDATED
TCEB2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-151s1c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-61s1c1
Sequence:CCGGCACCATCTTTACGGACGCCAACTCGAGTTGGCGTCCGTAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-326s1c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-170s1c1
Sequence:CCGGCAGCTCCTTGATGATGGCAAACTCGAGTTTGCCATCATCAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-87s21c1
Sequence:CCGGGAGCACCGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-50s21c1
Sequence:CCGGGCCACAAGACCACCATCTTTACTCGAGTAAAGATGGTGGTCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-259s21c1
Sequence:CCGGTTCCGAGCAGATGACACCTTCCTCGAGGAAGGTGTCATCTGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-325s21c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-150s21c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026305
VALIDATED
TCEB2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-151s1c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-61s1c1
Sequence:CCGGCACCATCTTTACGGACGCCAACTCGAGTTGGCGTCCGTAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-326s1c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-170s1c1
Sequence:CCGGCAGCTCCTTGATGATGGCAAACTCGAGTTTGCCATCATCAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-87s21c1
Sequence:CCGGGAGCACCGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-50s21c1
Sequence:CCGGGCCACAAGACCACCATCTTTACTCGAGTAAAGATGGTGGTCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-259s21c1
Sequence:CCGGTTCCGAGCAGATGACACCTTCCTCGAGGAAGGTGTCATCTGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-325s21c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-150s21c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026305
VALIDATED
TCEB2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-151s1c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-61s1c1
Sequence:CCGGCACCATCTTTACGGACGCCAACTCGAGTTGGCGTCCGTAAAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-326s1c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026305.1-170s1c1
Sequence:CCGGCAGCTCCTTGATGATGGCAAACTCGAGTTTGCCATCATCAAGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-87s21c1
Sequence:CCGGGAGCACCGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-50s21c1
Sequence:CCGGGCCACAAGACCACCATCTTTACTCGAGTAAAGATGGTGGTCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-259s21c1
Sequence:CCGGTTCCGAGCAGATGACACCTTCCTCGAGGAAGGTGTCATCTGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-325s21c1
Sequence:CCGGGATGTGATGAAGCCACAGGATCTCGAGATCCTGTGGCTTCATCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026305.2-150s21c1
Sequence:CCGGGCGGCTTTACAAGGATGACCACTCGAGTGGTCATCCTTGTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007108
VALIDATED
TCEB2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-75s1c1
Sequence:CCGGCGAACTGAAGCGCATCGTCGACTCGAGTCGACGATGCGCTTCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-187s1c1
Sequence:CCGGACCAGTCAAACAGCACGGCCACTCGAGTGGCCGTGCTGTTTGACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-47s1c1
Sequence:CCGGCGGACGCCAAGGAGTCCAGCACTCGAGTGCTGGACTCCTTGGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-148s1c1
Sequence:CCGGCTCTTGGATGATGGCAAGACACTCGAGTGTCTTGCCATCATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-123s1c1
Sequence:CCGGGCAGCGGCTGTACAAGGATGACTCGAGTCATCCTTGTACAGCCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-348s21c1
Sequence:CCGGAGAGCTGCCCGATGTGATGAACTCGAGTTCATCACATCGGGCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-191s21c1
Sequence:CCGGACAAGGATGACCAACTCTTGGCTCGAGCCAAGAGTTGGTCATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-818s21c1
Sequence:CCGGGACGATGGCCAAGAGCAGAAACTCGAGTTTCTGCTCTTGGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-383s21c1
Sequence:CCGGGAAGCAGTGCCAATGAACAAGCTCGAGCTTGTTCATTGGCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-292s21c1
Sequence:CCGGTTCCGGGCAGATGACACCTTTCTCGAGAAAGGTGTCATCTGCCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-395s21c1
Sequence:CCGGATGAACAAGCCGTGCAGTGAGCTCGAGCTCACTGCACGGCTTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-120s21c1
Sequence:CCGGCAGCACGGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-648s21c1
Sequence:CCGGCAAGCCATTGTTAGCAGCTAGCTCGAGCTAGCTGCTAACAATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007108
VALIDATED
TCEB2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-75s1c1
Sequence:CCGGCGAACTGAAGCGCATCGTCGACTCGAGTCGACGATGCGCTTCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-187s1c1
Sequence:CCGGACCAGTCAAACAGCACGGCCACTCGAGTGGCCGTGCTGTTTGACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-47s1c1
Sequence:CCGGCGGACGCCAAGGAGTCCAGCACTCGAGTGCTGGACTCCTTGGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-148s1c1
Sequence:CCGGCTCTTGGATGATGGCAAGACACTCGAGTGTCTTGCCATCATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-123s1c1
Sequence:CCGGGCAGCGGCTGTACAAGGATGACTCGAGTCATCCTTGTACAGCCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-348s21c1
Sequence:CCGGAGAGCTGCCCGATGTGATGAACTCGAGTTCATCACATCGGGCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-191s21c1
Sequence:CCGGACAAGGATGACCAACTCTTGGCTCGAGCCAAGAGTTGGTCATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-818s21c1
Sequence:CCGGGACGATGGCCAAGAGCAGAAACTCGAGTTTCTGCTCTTGGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-383s21c1
Sequence:CCGGGAAGCAGTGCCAATGAACAAGCTCGAGCTTGTTCATTGGCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-292s21c1
Sequence:CCGGTTCCGGGCAGATGACACCTTTCTCGAGAAAGGTGTCATCTGCCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-395s21c1
Sequence:CCGGATGAACAAGCCGTGCAGTGAGCTCGAGCTCACTGCACGGCTTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-120s21c1
Sequence:CCGGCAGCACGGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-648s21c1
Sequence:CCGGCAAGCCATTGTTAGCAGCTAGCTCGAGCTAGCTGCTAACAATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007108
VALIDATED
TCEB2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-75s1c1
Sequence:CCGGCGAACTGAAGCGCATCGTCGACTCGAGTCGACGATGCGCTTCAGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-187s1c1
Sequence:CCGGACCAGTCAAACAGCACGGCCACTCGAGTGGCCGTGCTGTTTGACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007108.1-47s1c1
Sequence:CCGGCGGACGCCAAGGAGTCCAGCACTCGAGTGCTGGACTCCTTGGCGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-148s1c1
Sequence:CCGGCTCTTGGATGATGGCAAGACACTCGAGTGTCTTGCCATCATCCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_007108.1-123s1c1
Sequence:CCGGGCAGCGGCTGTACAAGGATGACTCGAGTCATCCTTGTACAGCCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-348s21c1
Sequence:CCGGAGAGCTGCCCGATGTGATGAACTCGAGTTCATCACATCGGGCAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-191s21c1
Sequence:CCGGACAAGGATGACCAACTCTTGGCTCGAGCCAAGAGTTGGTCATCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-818s21c1
Sequence:CCGGGACGATGGCCAAGAGCAGAAACTCGAGTTTCTGCTCTTGGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-383s21c1
Sequence:CCGGGAAGCAGTGCCAATGAACAAGCTCGAGCTTGTTCATTGGCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-292s21c1
Sequence:CCGGTTCCGGGCAGATGACACCTTTCTCGAGAAAGGTGTCATCTGCCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-395s21c1
Sequence:CCGGATGAACAAGCCGTGCAGTGAGCTCGAGCTCACTGCACGGCTTGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007108.2-120s21c1
Sequence:CCGGCAGCACGGTGTTCGAACTGAACTCGAGTTCAGTTCGAACACCGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007108.2-648s21c1
Sequence:CCGGCAAGCCATTGTTAGCAGCTAGCTCGAGCTAGCTGCTAACAATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks