EMAIL THIS PAGE TO A FRIEND

TCEB2P2

transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) pseudogene 2

Species: Human TCEB2P2(253665)
Gene ID:
2 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_171447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_171447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_171447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_171447
TCEB2P2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) pseudogene 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-87s1c1
Sequence:CCGGCGTCGTGGAGGGAATCCTCAACTCGAGTTGAGGATTCCCTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-81s1c1
Sequence:CCGGGAAGCGCGTCGTGGAGGGAATCTCGAGATTCCCTCCACGACGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-144s1c1
Sequence:CCGGCCAACTCTTGGATGATGGCAACTCGAGTTGCCATCATCCAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c1
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-139s1c1
Sequence:CCGGGACTACCAACTCTTGGATGATCTCGAGATCATCCAAGAGTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c2
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_171447
TCEB2P2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) pseudogene 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-87s1c1
Sequence:CCGGCGTCGTGGAGGGAATCCTCAACTCGAGTTGAGGATTCCCTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-81s1c1
Sequence:CCGGGAAGCGCGTCGTGGAGGGAATCTCGAGATTCCCTCCACGACGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-144s1c1
Sequence:CCGGCCAACTCTTGGATGATGGCAACTCGAGTTGCCATCATCCAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c1
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-139s1c1
Sequence:CCGGGACTACCAACTCTTGGATGATCTCGAGATCATCCAAGAGTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c2
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_171447
TCEB2P2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B) pseudogene 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-87s1c1
Sequence:CCGGCGTCGTGGAGGGAATCCTCAACTCGAGTTGAGGATTCCCTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-81s1c1
Sequence:CCGGGAAGCGCGTCGTGGAGGGAATCTCGAGATTCCCTCCACGACGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-144s1c1
Sequence:CCGGCCAACTCTTGGATGATGGCAACTCGAGTTGCCATCATCCAAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c1
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-139s1c1
Sequence:CCGGGACTACCAACTCTTGGATGATCTCGAGATCATCCAAGAGTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171447.1-127s1c2
Sequence:CCGGCGGCTGTACAAGGACTACCAACTCGAGTTGGTAGTCCTTGTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks