EMAIL THIS PAGE TO A FRIEND

TCEB3

transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)

Synonyms: EloA SIII SIII p110 TCEB3A
UniProtKB ID: Q14241, B2R7Q8, Q8IXH1
Gene ID:
Human(6924) Summary: This gene encodes the protein elongin A, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. [provided by RefSeq, Jul 2008]
Mouse(27224) transcription elongation factor B (SIII), polypeptide 3
Rat(25562) transcription elongation factor B (SIII), polypeptide 3
Zebrafish(386968) transcription elongation factor B (SIII), polypeptide 3
chicken(419683) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Horse(100071575) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
domestic cat(101096247) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
dog(478188) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
cow(784844) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
sheep(101120903) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
domestic guinea pig(100722356) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
naked mole-rat(101713591) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Domestic Rabbit(100357661) transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003198 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003198 Rosetta Predictions human pricing
NM_017103 Rosetta Predictions rat pricing
NM_013736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108123 predicted 244
2 SASI_Hs01_00108124 predicted 1631
3 SASI_Hs01_00108125 predicted 1780
4 SASI_Hs01_00108126 predicted 487
5 SASI_Hs01_00108127 predicted 988
6 SASI_Hs01_00108128 predicted 2004
7 SASI_Hs01_00108129 predicted 1851
8 SASI_Hs01_00108130 predicted 2259
9 SASI_Hs01_00108132 predicted 1028
10 SASI_Hs02_00335235 predicted 1854
11 SASI_Hs01_00108131 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030474 predicted 2140
2 SASI_Rn01_00030475 predicted 1663
3 SASI_Rn01_00030476 predicted 781
4 SASI_Rn02_00261333 predicted 2348
5 SASI_Rn01_00030477 predicted 1568
6 SASI_Rn01_00030478 predicted 209
7 SASI_Rn01_00030479 predicted 542
8 SASI_Rn01_00030480 predicted 2037
9 SASI_Rn01_00030481 predicted 1576
10 SASI_Rn01_00030483 predicted 226
11 SASI_Rn01_00030482 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165131 predicted 721
2 SASI_Mm01_00165132 predicted 1662
3 SASI_Mm01_00165133 predicted 1772
4 SASI_Mm01_00165135 predicted 1003
5 SASI_Mm01_00165136 predicted 475
6 SASI_Mm01_00165137 predicted 2307
7 SASI_Mm01_00165138 predicted 491
8 SASI_Mm01_00165139 predicted 2319
9 SASI_Mm01_00165140 predicted 1604
10 SASI_Mm02_00322677 predicted 575
11 SASI_Mm01_00165134 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013736
VALIDATED
TCEB3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-3468s1c1
Sequence:CCGGCCCTATTTCTAGGTCGCATAACTCGAGTTATGCGACCTAGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013736.2-1523s1c1
Sequence:CCGGCTTGAGTTGATTCCCTCCTTTCTCGAGAAAGGAGGGAATCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1691s1c1
Sequence:CCGGCGGGTGCTTAAGAATAATATTCTCGAGAATATTATTCTTAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1690s1c1
Sequence:CCGGCCGGGTGCTTAAGAATAATATCTCGAGATATTATTCTTAAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1293s1c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-248s21c1
Sequence:CCGGTGGTTCCAGTAGAGCGAAATACTCGAGTATTTCGCTCTACTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-1292s21c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-2296s21c1
Sequence:CCGGATGATGGCCAAGACCATTAAACTCGAGTTTAATGGTCTTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013736.4-2809s21c1
Sequence:CCGGCTGAGTAGACACTGGTCAAAGCTCGAGCTTTGACCAGTGTCTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-131s21c1
Sequence:CCGGTACCTATCACAGTAGACATTCCTCGAGGAATGTCTACTGTGATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013736
VALIDATED
TCEB3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-3468s1c1
Sequence:CCGGCCCTATTTCTAGGTCGCATAACTCGAGTTATGCGACCTAGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013736.2-1523s1c1
Sequence:CCGGCTTGAGTTGATTCCCTCCTTTCTCGAGAAAGGAGGGAATCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1691s1c1
Sequence:CCGGCGGGTGCTTAAGAATAATATTCTCGAGAATATTATTCTTAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1690s1c1
Sequence:CCGGCCGGGTGCTTAAGAATAATATCTCGAGATATTATTCTTAAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1293s1c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-248s21c1
Sequence:CCGGTGGTTCCAGTAGAGCGAAATACTCGAGTATTTCGCTCTACTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-1292s21c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-2296s21c1
Sequence:CCGGATGATGGCCAAGACCATTAAACTCGAGTTTAATGGTCTTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013736.4-2809s21c1
Sequence:CCGGCTGAGTAGACACTGGTCAAAGCTCGAGCTTTGACCAGTGTCTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-131s21c1
Sequence:CCGGTACCTATCACAGTAGACATTCCTCGAGGAATGTCTACTGTGATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013736
VALIDATED
TCEB3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-3468s1c1
Sequence:CCGGCCCTATTTCTAGGTCGCATAACTCGAGTTATGCGACCTAGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013736.2-1523s1c1
Sequence:CCGGCTTGAGTTGATTCCCTCCTTTCTCGAGAAAGGAGGGAATCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1691s1c1
Sequence:CCGGCGGGTGCTTAAGAATAATATTCTCGAGAATATTATTCTTAAGCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1690s1c1
Sequence:CCGGCCGGGTGCTTAAGAATAATATCTCGAGATATTATTCTTAAGCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013736.2-1293s1c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-248s21c1
Sequence:CCGGTGGTTCCAGTAGAGCGAAATACTCGAGTATTTCGCTCTACTGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-1292s21c1
Sequence:CCGGCCAGTACAGCACTTGGAGAAACTCGAGTTTCTCCAAGTGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-2296s21c1
Sequence:CCGGATGATGGCCAAGACCATTAAACTCGAGTTTAATGGTCTTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013736.4-2809s21c1
Sequence:CCGGCTGAGTAGACACTGGTCAAAGCTCGAGCTTTGACCAGTGTCTACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013736.4-131s21c1
Sequence:CCGGTACCTATCACAGTAGACATTCCTCGAGGAATGTCTACTGTGATAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003198
VALIDATED
TCEB3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003198.1-2353s1c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-990s1c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-2159s1c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-1634s1c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-137s1c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-2265s21c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1740s21c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-243s21c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003198.2-2459s21c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1096s21c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003198
VALIDATED
TCEB3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003198.1-2353s1c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-990s1c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-2159s1c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-1634s1c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-137s1c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-2265s21c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1740s21c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-243s21c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003198.2-2459s21c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1096s21c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003198
VALIDATED
TCEB3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003198.1-2353s1c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-990s1c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-2159s1c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003198.1-1634s1c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003198.1-137s1c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-2265s21c1
Sequence:CCGGCGCCAGTAGCATCAGCTTTAACTCGAGTTAAAGCTGATGCTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1740s21c1
Sequence:CCGGGCAGGTGTATTCTGGTTCCAACTCGAGTTGGAACCAGAATACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-243s21c1
Sequence:CCGGCCTGCCTATTACAGTAGACATCTCGAGATGTCTACTGTAATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003198.2-2459s21c1
Sequence:CCGGCTGAGGACTTGCCTTGGAAATCTCGAGATTTCCAAGGCAAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003198.2-1096s21c1
Sequence:CCGGGCTTCAGACAACCACCTGAAACTCGAGTTTCAGGTGGTTGTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks