EMAIL THIS PAGE TO A FRIEND

TCEB3B

transcription elongation factor B polypeptide 3B (elongin A2)

Synonyms: ELOA2 HsT832 TCEB3L
Species: Human TCEB3B(51224)
UniProtKB ID: Q8IYF1, Q9P2V9
Gene ID:
Human(51224) Summary: This gene encodes the transcriptionally active subunit of the SIII (or elongin) transcription elongation factor complex, which also includes two regulatory subunits, elongins B and C. This complex acts to increase the rate of RNA chain elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites along the DNA template. Whereas a related protein with similar function, elongin A, is ubiquitously expressed, the encoded protein is specifically expressed in the testis, suggesting it may have a role in spermatogenesis. [provided by RefSeq, Jul 2008]
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016427 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016427 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119056 predicted 2674
2 SASI_Hs01_00119057 predicted 1456
3 SASI_Hs01_00119058 predicted 2061
4 SASI_Hs01_00119059 predicted 2042
5 SASI_Hs02_00349452 predicted 2093
6 SASI_Hs01_00119060 predicted 2109
7 SASI_Hs01_00119061 predicted 2706
8 SASI_Hs01_00119062 predicted 1623
9 SASI_Hs01_00119063 predicted 2063
10 SASI_Hs01_00119064 predicted 1370
11 SASI_Hs01_00119065 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016427
TCEB3B MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B polypeptide 3B (elongin A2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2861s21c1
Sequence:CCGGTTGGATGTTCACTGATAATTTCTCGAGAAATTATCAGTGAACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016427.2-2265s21c1
Sequence:CCGGGAGGCAAAGATGATCTGTTTCCTCGAGGAAACAGATCATCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2890s21c1
Sequence:CCGGACCCTAGTTGTAATCATAAATCTCGAGATTTATGATTACAACTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2835s21c1
Sequence:CCGGATGAACGCATTGGGAACAATTCTCGAGAATTGTTCCCAATGCGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1408s1c1
Sequence:CCGGCGACTGCTCATTTGGACAGAACTCGAGTTCTGTCCAAATGAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2084s1c1
Sequence:CCGGCGTTAGAGAGACAGACGAATTCTCGAGAATTCGTCTGTCTCTCTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1280s1c1
Sequence:CCGGGCACAGTCACTCGAACAAGAACTCGAGTTCTTGTTCGAGTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2210s1c1
Sequence:CCGGGAGAGTAATGACAACGAATATCTCGAGATATTCGTTGTCATTACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1088s1c1
Sequence:CCGGCCCTACTTTGATCAGGGAGAACTCGAGTTCTCCCTGATCAAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016427
TCEB3B MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B polypeptide 3B (elongin A2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2861s21c1
Sequence:CCGGTTGGATGTTCACTGATAATTTCTCGAGAAATTATCAGTGAACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016427.2-2265s21c1
Sequence:CCGGGAGGCAAAGATGATCTGTTTCCTCGAGGAAACAGATCATCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2890s21c1
Sequence:CCGGACCCTAGTTGTAATCATAAATCTCGAGATTTATGATTACAACTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2835s21c1
Sequence:CCGGATGAACGCATTGGGAACAATTCTCGAGAATTGTTCCCAATGCGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1408s1c1
Sequence:CCGGCGACTGCTCATTTGGACAGAACTCGAGTTCTGTCCAAATGAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2084s1c1
Sequence:CCGGCGTTAGAGAGACAGACGAATTCTCGAGAATTCGTCTGTCTCTCTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1280s1c1
Sequence:CCGGGCACAGTCACTCGAACAAGAACTCGAGTTCTTGTTCGAGTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2210s1c1
Sequence:CCGGGAGAGTAATGACAACGAATATCTCGAGATATTCGTTGTCATTACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1088s1c1
Sequence:CCGGCCCTACTTTGATCAGGGAGAACTCGAGTTCTCCCTGATCAAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016427
TCEB3B MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B polypeptide 3B (elongin A2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2861s21c1
Sequence:CCGGTTGGATGTTCACTGATAATTTCTCGAGAAATTATCAGTGAACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016427.2-2265s21c1
Sequence:CCGGGAGGCAAAGATGATCTGTTTCCTCGAGGAAACAGATCATCTTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2890s21c1
Sequence:CCGGACCCTAGTTGTAATCATAAATCTCGAGATTTATGATTACAACTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016427.2-2835s21c1
Sequence:CCGGATGAACGCATTGGGAACAATTCTCGAGAATTGTTCCCAATGCGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1408s1c1
Sequence:CCGGCGACTGCTCATTTGGACAGAACTCGAGTTCTGTCCAAATGAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2084s1c1
Sequence:CCGGCGTTAGAGAGACAGACGAATTCTCGAGAATTCGTCTGTCTCTCTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1280s1c1
Sequence:CCGGGCACAGTCACTCGAACAAGAACTCGAGTTCTTGTTCGAGTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-2210s1c1
Sequence:CCGGGAGAGTAATGACAACGAATATCTCGAGATATTCGTTGTCATTACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016427.2-1088s1c1
Sequence:CCGGCCCTACTTTGATCAGGGAGAACTCGAGTTCTCCCTGATCAAAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks