EMAIL THIS PAGE TO A FRIEND

TCEB3C

transcription elongation factor B polypeptide 3C (elongin A3)

Synonyms: HsT829 TCEB3L2
Species: Human TCEB3C(162699)
UniProtKB ID: Q8NG57
Gene ID:
Human(162699) Summary: The SIII (or elongin) transcription elongation factor complex stimulates the rate of transcription elongation by RNA polymerase II by suppressing the transient pausing of the polymerase at many sites along the DNA template. This complex is a heterotrimer, composed of the transcriptionally active subunit A, A2 or A3 (or elongin A, A2 or A3) and two regulatory subunits, B and C (or elongin B and C). This gene encodes subunit A3. A3 and A are ubiquitously expressed, whereas A2 is specifically expressed in the testis. [provided by RefSeq, Mar 2010]
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145653 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145653 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124209 predicted 1408
2 SASI_Hs01_00124210 predicted 1459
3 SASI_Hs01_00124211 predicted 530
4 SASI_Hs01_00124212 predicted 1347
5 SASI_Hs01_00124213 predicted 939
6 SASI_Hs01_00124214 predicted 1392
7 SASI_Hs01_00124215 predicted 1511
8 SASI_Hs01_00124216 predicted 1563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145653
TCEB3C MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B polypeptide 3C (elongin A3)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1333s1c1
Sequence:CCGGCGACAGACAAAGATGATCTGTCTCGAGACAGATCATCTTTGTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1156s1c1
Sequence:CCGGGCTCGAGAGACAGATGAATTACTCGAGTAATTCATCTGTCTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1165s1c1
Sequence:CCGGACAGATGAATTATGGAGGATTCTCGAGAATCCTCCATAATTCATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-697s1c1
Sequence:CCGGGCTTCGGCTCAGAAATCGCCTCTCGAGAGGCGATTTCTGAGCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1279s1c1
Sequence:CCGGCTGCGAGTAGTGACCACGAAACTCGAGTTTCGTGGTCACTACTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1317s21c1
Sequence:CCGGTCGGTTCTTGAACCCGTTCTGCTCGAGCAGAACGGGTTCAAGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1174s21c1
Sequence:CCGGGACGCAGAGTGAACGCTAAGACTCGAGTCTTAGCGTTCACTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145653
TCEB3C MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B polypeptide 3C (elongin A3)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1333s1c1
Sequence:CCGGCGACAGACAAAGATGATCTGTCTCGAGACAGATCATCTTTGTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1156s1c1
Sequence:CCGGGCTCGAGAGACAGATGAATTACTCGAGTAATTCATCTGTCTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1165s1c1
Sequence:CCGGACAGATGAATTATGGAGGATTCTCGAGAATCCTCCATAATTCATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-697s1c1
Sequence:CCGGGCTTCGGCTCAGAAATCGCCTCTCGAGAGGCGATTTCTGAGCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1279s1c1
Sequence:CCGGCTGCGAGTAGTGACCACGAAACTCGAGTTTCGTGGTCACTACTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1317s21c1
Sequence:CCGGTCGGTTCTTGAACCCGTTCTGCTCGAGCAGAACGGGTTCAAGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1174s21c1
Sequence:CCGGGACGCAGAGTGAACGCTAAGACTCGAGTCTTAGCGTTCACTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145653
TCEB3C MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B polypeptide 3C (elongin A3)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1333s1c1
Sequence:CCGGCGACAGACAAAGATGATCTGTCTCGAGACAGATCATCTTTGTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1156s1c1
Sequence:CCGGGCTCGAGAGACAGATGAATTACTCGAGTAATTCATCTGTCTCTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1165s1c1
Sequence:CCGGACAGATGAATTATGGAGGATTCTCGAGAATCCTCCATAATTCATCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-697s1c1
Sequence:CCGGGCTTCGGCTCAGAAATCGCCTCTCGAGAGGCGATTTCTGAGCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145653.1-1279s1c1
Sequence:CCGGCTGCGAGTAGTGACCACGAAACTCGAGTTTCGTGGTCACTACTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1317s21c1
Sequence:CCGGTCGGTTCTTGAACCCGTTCTGCTCGAGCAGAACGGGTTCAAGAACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145653.3-1174s21c1
Sequence:CCGGGACGCAGAGTGAACGCTAAGACTCGAGTCTTAGCGTTCACTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks