EMAIL THIS PAGE TO A FRIEND

TCEB3CL

transcription elongation factor B polypeptide 3C-like

Synonyms: HsT828
Species: Human TCEB3CL(728929)
UniProtKB ID: Q3SY89, Q3MI93
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100817 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322367 predicted 1180
2 SASI_Hs02_00322368 predicted 1220
3 SASI_Hs02_00322369 predicted 302
4 SASI_Hs02_00322370 predicted 701
5 SASI_Hs02_00322371 predicted 1151
6 SASI_Hs02_00322372 predicted 890
7 SASI_Hs02_00322373 predicted 300
8 SASI_Hs02_00322374 predicted 1162
9 SASI_Hs02_00322375 predicted 1157
10 SASI_Hs02_00322376 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100817
TCEB3CL MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor B polypeptide 3C-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-939s21c1
Sequence:CCGGACGCAGAGTGAACGCTAAGATCTCGAGATCTTAGCGTTCACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1127s21c1
Sequence:CCGGACCGCACAGAGAAAGACAATGCTCGAGCATTGTCTTTCTCTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-133s21c1
Sequence:CCGGGCGGAGACTGGAATCAGAAAGCTCGAGCTTTCTGATTCCAGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1158s21c1
Sequence:CCGGTCGAGAGACAGATGAATTATGCTCGAGCATAATTCATCTGTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1360s21c1
Sequence:CCGGTCTGTGGCCAAGACGCCTTATCTCGAGATAAGGCGTCTTGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100817
TCEB3CL MISSION shRNA shRNA Plasmid DNA
transcription elongation factor B polypeptide 3C-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-939s21c1
Sequence:CCGGACGCAGAGTGAACGCTAAGATCTCGAGATCTTAGCGTTCACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1127s21c1
Sequence:CCGGACCGCACAGAGAAAGACAATGCTCGAGCATTGTCTTTCTCTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-133s21c1
Sequence:CCGGGCGGAGACTGGAATCAGAAAGCTCGAGCTTTCTGATTCCAGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1158s21c1
Sequence:CCGGTCGAGAGACAGATGAATTATGCTCGAGCATAATTCATCTGTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1360s21c1
Sequence:CCGGTCTGTGGCCAAGACGCCTTATCTCGAGATAAGGCGTCTTGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100817
TCEB3CL MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor B polypeptide 3C-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-939s21c1
Sequence:CCGGACGCAGAGTGAACGCTAAGATCTCGAGATCTTAGCGTTCACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1127s21c1
Sequence:CCGGACCGCACAGAGAAAGACAATGCTCGAGCATTGTCTTTCTCTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-133s21c1
Sequence:CCGGGCGGAGACTGGAATCAGAAAGCTCGAGCTTTCTGATTCCAGTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1158s21c1
Sequence:CCGGTCGAGAGACAGATGAATTATGCTCGAGCATAATTCATCTGTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100817.1-1360s21c1
Sequence:CCGGTCTGTGGCCAAGACGCCTTATCTCGAGATAAGGCGTCTTGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks