EMAIL THIS PAGE TO A FRIEND

TCERG1

transcription elongation regulator 1

Synonyms: CA150 TAF2S Urn1
UniProtKB ID: O14776, Q2NKN2, Q59EA1
Gene ID:
Human(10915) Summary: This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(56070) transcription elongation regulator 1 (CA150)
Rat(307474) transcription elongation regulator 1
chicken(416349) transcription elongation regulator 1
domestic cat(101083567) transcription elongation regulator 1
dog(478052) transcription elongation regulator 1
naked mole-rat(101699595) transcription elongation regulator 1
domestic guinea pig(100731325) transcription elongation regulator 1
cow(540964) transcription elongation regulator 1
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040006 Rosetta Predictions human pricing
NM_006706 Rosetta Predictions human pricing
NM_001107390 Rosetta Predictions rat pricing
NM_001039474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178685 predicted 2049
2 SASI_Hs01_00178686 predicted 331
3 SASI_Hs01_00178687 predicted 3170
4 SASI_Hs01_00178688 predicted 3351
5 SASI_Hs01_00178689 predicted 1772
6 SASI_Hs01_00178690 predicted 1751
7 SASI_Hs01_00178691 predicted 3331
8 SASI_Hs01_00178692 predicted 3344
9 SASI_Hs01_00178693 predicted 1893
10 SASI_Hs01_00178694 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174189 predicted 2109
2 SASI_Hs01_00174190 predicted 330
3 SASI_Hs01_00174191 predicted 3240
4 SASI_Hs01_00174192 predicted 3418
5 SASI_Hs01_00174193 predicted 1838
6 SASI_Hs01_00174194 predicted 1813
7 SASI_Hs01_00174195 predicted 3397
8 SASI_Hs01_00174196 predicted 3408
9 SASI_Hs01_00174197 predicted 1443
10 SASI_Hs01_00174198 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228345 predicted 2455
2 SASI_Rn02_00228346 predicted 2986
3 SASI_Rn02_00228347 predicted 1323
4 SASI_Rn02_00228348 predicted 2064
5 SASI_Rn02_00228349 predicted 1489
6 SASI_Rn02_00228350 predicted 2192
7 SASI_Rn02_00228351 predicted 2673
8 SASI_Rn02_00228352 predicted 3187
9 SASI_Rn02_00228353 predicted 3363
10 SASI_Rn02_00228354 predicted 2244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045987 predicted 1655
2 SASI_Mm01_00045988 predicted 2939
3 SASI_Mm01_00045989 predicted 3050
4 SASI_Mm01_00045990 predicted 1839
5 SASI_Mm01_00045991 predicted 2823
6 SASI_Mm01_00045992 predicted 2257
7 SASI_Mm01_00045993 predicted 2419
8 SASI_Mm01_00045994 predicted 2885
9 SASI_Mm01_00045995 predicted 1815
10 SASI_Mm01_00045996 predicted 2124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039474
TCERG1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation regulator 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000429707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1897s21c1
Sequence:CCGGGAATGAAGATGAGCCTATTAACTCGAGTTAATAGGCTCATCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-2097s21c1
Sequence:CCGGAGTTGCACAAGATAGTATTTGCTCGAGCAAATACTATCTTGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1849s21c1
Sequence:CCGGGTTCTCAATGAGCGCAATTAACTCGAGTTAATTGCGCTCATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039474
TCERG1 MISSION shRNA shRNA Plasmid DNA
transcription elongation regulator 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000429707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1897s21c1
Sequence:CCGGGAATGAAGATGAGCCTATTAACTCGAGTTAATAGGCTCATCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-2097s21c1
Sequence:CCGGAGTTGCACAAGATAGTATTTGCTCGAGCAAATACTATCTTGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1849s21c1
Sequence:CCGGGTTCTCAATGAGCGCAATTAACTCGAGTTAATTGCGCTCATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039474
TCERG1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation regulator 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000429707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1897s21c1
Sequence:CCGGGAATGAAGATGAGCCTATTAACTCGAGTTAATAGGCTCATCTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-2097s21c1
Sequence:CCGGAGTTGCACAAGATAGTATTTGCTCGAGCAAATACTATCTTGTGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039474.1-1849s21c1
Sequence:CCGGGTTCTCAATGAGCGCAATTAACTCGAGTTAATTGCGCTCATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006706
VALIDATED
TCERG1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation regulator 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1174s21c1
Sequence:GTACCGGAGGTGTAGCAATGATGCAAATCTCGAGATTTGCATCATTGCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-3960s21c1
Sequence:CCGGGGTATGGAACCACGGTCATAACTCGAGTTATGACCGTGGTTCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1921s21c1
Sequence:CCGGACGGAAGAGAGACGATAATAACTCGAGTTATTATCGTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1519s21c1
Sequence:CCGGTCCTAAAGAAGAGCCTATAAACTCGAGTTTATAGGCTCTTCTTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1225s21c1
Sequence:CCGGTACCACCAAGACCGGTGTATTCTCGAGAATACACCGGTCTTGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-417s1c1
Sequence:CCGGCGGAGGAGATATGGGTTGAAACTCGAGTTTCAACCCATATCTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006706.2-2561s1c1
Sequence:CCGGGCCAAGAATTTAGACTCAGAACTCGAGTTCTGAGTCTAAATTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-2492s1c1
Sequence:CCGGCCACGTTACAAAGCAGTAGATCTCGAGATCTACTGCTTTGTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-1238s1c1
Sequence:CCGGCCTCCTATCGTACCCATGATACTCGAGTATCATGGGTACGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006706.2-1901s1c1
Sequence:CCGGCGGAAGAGAGACGATAATAAACTCGAGTTTATTATCGTCTCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006706
VALIDATED
TCERG1 MISSION shRNA shRNA Plasmid DNA
transcription elongation regulator 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1174s21c1
Sequence:GTACCGGAGGTGTAGCAATGATGCAAATCTCGAGATTTGCATCATTGCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-3960s21c1
Sequence:CCGGGGTATGGAACCACGGTCATAACTCGAGTTATGACCGTGGTTCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1921s21c1
Sequence:CCGGACGGAAGAGAGACGATAATAACTCGAGTTATTATCGTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1519s21c1
Sequence:CCGGTCCTAAAGAAGAGCCTATAAACTCGAGTTTATAGGCTCTTCTTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1225s21c1
Sequence:CCGGTACCACCAAGACCGGTGTATTCTCGAGAATACACCGGTCTTGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-417s1c1
Sequence:CCGGCGGAGGAGATATGGGTTGAAACTCGAGTTTCAACCCATATCTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006706.2-2561s1c1
Sequence:CCGGGCCAAGAATTTAGACTCAGAACTCGAGTTCTGAGTCTAAATTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-2492s1c1
Sequence:CCGGCCACGTTACAAAGCAGTAGATCTCGAGATCTACTGCTTTGTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-1238s1c1
Sequence:CCGGCCTCCTATCGTACCCATGATACTCGAGTATCATGGGTACGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006706.2-1901s1c1
Sequence:CCGGCGGAAGAGAGACGATAATAAACTCGAGTTTATTATCGTCTCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006706
VALIDATED
TCERG1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation regulator 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1174s21c1
Sequence:GTACCGGAGGTGTAGCAATGATGCAAATCTCGAGATTTGCATCATTGCTACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-3960s21c1
Sequence:CCGGGGTATGGAACCACGGTCATAACTCGAGTTATGACCGTGGTTCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1921s21c1
Sequence:CCGGACGGAAGAGAGACGATAATAACTCGAGTTATTATCGTCTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006706.3-1519s21c1
Sequence:CCGGTCCTAAAGAAGAGCCTATAAACTCGAGTTTATAGGCTCTTCTTTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006706.3-1225s21c1
Sequence:CCGGTACCACCAAGACCGGTGTATTCTCGAGAATACACCGGTCTTGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-417s1c1
Sequence:CCGGCGGAGGAGATATGGGTTGAAACTCGAGTTTCAACCCATATCTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006706.2-2561s1c1
Sequence:CCGGGCCAAGAATTTAGACTCAGAACTCGAGTTCTGAGTCTAAATTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-2492s1c1
Sequence:CCGGCCACGTTACAAAGCAGTAGATCTCGAGATCTACTGCTTTGTAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006706.2-1238s1c1
Sequence:CCGGCCTCCTATCGTACCCATGATACTCGAGTATCATGGGTACGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_006706.2-1901s1c1
Sequence:CCGGCGGAAGAGAGACGATAATAAACTCGAGTTTATTATCGTCTCTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019512
TCERG1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation regulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019512.1-3321s1c1
Sequence:CCGGGCCTATGTTGATGACCTGGATCTCGAGATCCAGGTCATCAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1301s1c1
Sequence:CCGGGCAGTTTCTGAGTGGACTGAACTCGAGTTCAGTCCACTCAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2484s1c1
Sequence:CCGGCCCGATATAAAGCGGTGGATACTCGAGTATCCACCGCTTTATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2084s1c1
Sequence:CCGGCCTCGGTACTTGCTTCTCAATCTCGAGATTGAGAAGCAAGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1891s1c1
Sequence:CCGGGCGGAAGAGAGATGATAATAACTCGAGTTATTATCATCTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019512
TCERG1 MISSION shRNA shRNA Plasmid DNA
transcription elongation regulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019512.1-3321s1c1
Sequence:CCGGGCCTATGTTGATGACCTGGATCTCGAGATCCAGGTCATCAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1301s1c1
Sequence:CCGGGCAGTTTCTGAGTGGACTGAACTCGAGTTCAGTCCACTCAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2484s1c1
Sequence:CCGGCCCGATATAAAGCGGTGGATACTCGAGTATCCACCGCTTTATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2084s1c1
Sequence:CCGGCCTCGGTACTTGCTTCTCAATCTCGAGATTGAGAAGCAAGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1891s1c1
Sequence:CCGGGCGGAAGAGAGATGATAATAACTCGAGTTATTATCATCTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019512
TCERG1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation regulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019512.1-3321s1c1
Sequence:CCGGGCCTATGTTGATGACCTGGATCTCGAGATCCAGGTCATCAACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1301s1c1
Sequence:CCGGGCAGTTTCTGAGTGGACTGAACTCGAGTTCAGTCCACTCAGAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2484s1c1
Sequence:CCGGCCCGATATAAAGCGGTGGATACTCGAGTATCCACCGCTTTATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-2084s1c1
Sequence:CCGGCCTCGGTACTTGCTTCTCAATCTCGAGATTGAGAAGCAAGTACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019512.1-1891s1c1
Sequence:CCGGGCGGAAGAGAGATGATAATAACTCGAGTTATTATCATCTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks