EMAIL THIS PAGE TO A FRIEND

TCERG1L

transcription elongation regulator 1-like

UniProtKB ID: Q5VWI1, Q5VWI2, Q86XM8
Gene ID:
Mouse(70571) transcription elongation regulator 1-like
Rat(361669) transcription elongation regulator 1-like
chicken(423969) transcription elongation regulator 1-like
domestic cat(101085835) transcription elongation regulator 1-like
Horse(100051859) transcription elongation regulator 1-like
dog(100687969) transcription elongation regulator 1-like
sheep(101107651) transcription elongation regulator 1-like
domestic guinea pig(100731800) transcription elongation regulator 1-like
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302897 ANTI-TCERG1L (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174937 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013291 MISSION® esiRNA esiRNA targeting human TCERG1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174937 Rosetta Predictions human pricing
NM_001130077 Rosetta Predictions rat pricing
NM_183289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067594 predicted 1559
2 SASI_Hs01_00067596 predicted 2054
3 SASI_Hs01_00067597 predicted 2163
4 SASI_Hs02_00368874 predicted 1624
5 SASI_Hs01_00067598 predicted 2181
6 SASI_Hs01_00067599 predicted 2255
7 SASI_Hs01_00067601 predicted 1985
8 SASI_Hs01_00067603 predicted 1687
9 SASI_Hs02_00368875 predicted 1817
10 SASI_Hs02_00368876 predicted 2035
11 SASI_Hs01_00067595 predicted 2101
12 SASI_Hs01_00067600 predicted 2170
13 SASI_Hs01_00067602 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255309 predicted 544
2 SASI_Rn02_00255310 predicted 1379
3 SASI_Rn02_00255311 predicted 1569
4 SASI_Rn02_00255312 predicted 1462
5 SASI_Rn02_00255313 predicted 484
6 SASI_Rn02_00255314 predicted 371
7 SASI_Rn02_00255315 predicted 430
8 SASI_Rn02_00255316 predicted 1408
9 SASI_Rn02_00255317 predicted 1116
10 SASI_Rn02_00255318 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350391 predicted 1543
2 SASI_Mm02_00350392 predicted 1622
3 SASI_Mm02_00350393 predicted 1849
4 SASI_Mm02_00350394 predicted 1720
5 SASI_Mm02_00350395 predicted 1531
6 SASI_Mm02_00350396 predicted 1580
7 SASI_Mm02_00350397 predicted 1817
8 SASI_Mm02_00350398 predicted 1736
9 SASI_Mm02_00350399 predicted 1574
10 SASI_Mm02_00350400 predicted 1533
11 SASI_Mm01_00091148 predicted 1038
12 SASI_Mm01_00091149 predicted 1558
13 SASI_Mm01_00091150 predicted 1652
14 SASI_Mm01_00091151 predicted 1441
15 SASI_Mm01_00091152 predicted 1404
16 SASI_Mm01_00091153 predicted 1697
17 SASI_Mm01_00091154 predicted 1447
18 SASI_Mm01_00091155 predicted 1527
19 SASI_Mm01_00091156 predicted 1032
20 SASI_Mm01_00091157 predicted 1682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183289
TCERG1L MISSION shRNA Bacterial Glycerol Stock
transcription elongation regulator 1-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183289.1-1409s1c1
Sequence:CCGGGCAGACTCACAAATTAAGTTTCTCGAGAAACTTAATTTGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-602s1c1
Sequence:CCGGCCCGGAGGAATCGGTACTCTTCTCGAGAAGAGTACCGATTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-878s1c1
Sequence:CCGGGCCGTGCCACTTCCTGACATTCTCGAGAATGTCAGGAAGTGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-739s1c1
Sequence:CCGGGTGGTTGTCATGACAGTCTTACTCGAGTAAGACTGTCATGACAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-708s1c1
Sequence:CCGGACTGTGGTATTAGCAGCTCAACTCGAGTTGAGCTGCTAATACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183289.3-2034s21c1
Sequence:CCGGCCATGAGATGTCGAGTCTTTACTCGAGTAAAGACTCGACATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-533s21c1
Sequence:CCGGAGATAAGAGGATGCCTAATTACTCGAGTAATTAGGCATCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-410s21c1
Sequence:CCGGGTGGCTGTTTGGTGGTCATTCCTCGAGGAATGACCACCAAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1684s21c1
Sequence:CCGGTATCGCCCAGGACCACATTTACTCGAGTAAATGTGGTCCTGGGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1502s21c1
Sequence:CCGGTTGGGAGAAAGAATTGCATAACTCGAGTTATGCAATTCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183289
TCERG1L MISSION shRNA shRNA Plasmid DNA
transcription elongation regulator 1-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183289.1-1409s1c1
Sequence:CCGGGCAGACTCACAAATTAAGTTTCTCGAGAAACTTAATTTGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-602s1c1
Sequence:CCGGCCCGGAGGAATCGGTACTCTTCTCGAGAAGAGTACCGATTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-878s1c1
Sequence:CCGGGCCGTGCCACTTCCTGACATTCTCGAGAATGTCAGGAAGTGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-739s1c1
Sequence:CCGGGTGGTTGTCATGACAGTCTTACTCGAGTAAGACTGTCATGACAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-708s1c1
Sequence:CCGGACTGTGGTATTAGCAGCTCAACTCGAGTTGAGCTGCTAATACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183289.3-2034s21c1
Sequence:CCGGCCATGAGATGTCGAGTCTTTACTCGAGTAAAGACTCGACATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-533s21c1
Sequence:CCGGAGATAAGAGGATGCCTAATTACTCGAGTAATTAGGCATCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-410s21c1
Sequence:CCGGGTGGCTGTTTGGTGGTCATTCCTCGAGGAATGACCACCAAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1684s21c1
Sequence:CCGGTATCGCCCAGGACCACATTTACTCGAGTAAATGTGGTCCTGGGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1502s21c1
Sequence:CCGGTTGGGAGAAAGAATTGCATAACTCGAGTTATGCAATTCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183289
TCERG1L MISSION shRNA Lentiviral Transduction Particles
transcription elongation regulator 1-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183289.1-1409s1c1
Sequence:CCGGGCAGACTCACAAATTAAGTTTCTCGAGAAACTTAATTTGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-602s1c1
Sequence:CCGGCCCGGAGGAATCGGTACTCTTCTCGAGAAGAGTACCGATTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-878s1c1
Sequence:CCGGGCCGTGCCACTTCCTGACATTCTCGAGAATGTCAGGAAGTGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-739s1c1
Sequence:CCGGGTGGTTGTCATGACAGTCTTACTCGAGTAAGACTGTCATGACAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183289.1-708s1c1
Sequence:CCGGACTGTGGTATTAGCAGCTCAACTCGAGTTGAGCTGCTAATACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183289.3-2034s21c1
Sequence:CCGGCCATGAGATGTCGAGTCTTTACTCGAGTAAAGACTCGACATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-533s21c1
Sequence:CCGGAGATAAGAGGATGCCTAATTACTCGAGTAATTAGGCATCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-410s21c1
Sequence:CCGGGTGGCTGTTTGGTGGTCATTCCTCGAGGAATGACCACCAAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1684s21c1
Sequence:CCGGTATCGCCCAGGACCACATTTACTCGAGTAAATGTGGTCCTGGGCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183289.3-1502s21c1
Sequence:CCGGTTGGGAGAAAGAATTGCATAACTCGAGTTATGCAATTCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174937
TCERG1L MISSION shRNA Bacterial Glycerol Stock
transcription elongation regulator 1-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1552s1c1
Sequence:CCGGGCTCAACTCTGAGGAACGAAACTCGAGTTTCGTTCCTCAGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1505s1c1
Sequence:CCGGTGGGAGAAAGAATTACACAAACTCGAGTTTGTGTAATTCTTTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-940s1c1
Sequence:CCGGCGTCTCAGATACAAGGACAGACTCGAGTCTGTCCTTGTATCTGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1382s1c1
Sequence:CCGGGAGGCAAAGAGAGAGGACAAACTCGAGTTTGTCCTCTCTCTTTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-662s1c1
Sequence:CCGGCCTCGTTTGCTGGCAAATCAACTCGAGTTGATTTGCCAGCAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2060s21c1
Sequence:CCGGGTGATACGTCGATCCCTTAATCTCGAGATTAAGGGATCGACGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2153s21c1
Sequence:CCGGACGGGAGCCTCTGTAACAATCCTCGAGGATTGTTACAGAGGCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174937
TCERG1L MISSION shRNA shRNA Plasmid DNA
transcription elongation regulator 1-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1552s1c1
Sequence:CCGGGCTCAACTCTGAGGAACGAAACTCGAGTTTCGTTCCTCAGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1505s1c1
Sequence:CCGGTGGGAGAAAGAATTACACAAACTCGAGTTTGTGTAATTCTTTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-940s1c1
Sequence:CCGGCGTCTCAGATACAAGGACAGACTCGAGTCTGTCCTTGTATCTGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1382s1c1
Sequence:CCGGGAGGCAAAGAGAGAGGACAAACTCGAGTTTGTCCTCTCTCTTTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-662s1c1
Sequence:CCGGCCTCGTTTGCTGGCAAATCAACTCGAGTTGATTTGCCAGCAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2060s21c1
Sequence:CCGGGTGATACGTCGATCCCTTAATCTCGAGATTAAGGGATCGACGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2153s21c1
Sequence:CCGGACGGGAGCCTCTGTAACAATCCTCGAGGATTGTTACAGAGGCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174937
TCERG1L MISSION shRNA Lentiviral Transduction Particles
transcription elongation regulator 1-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1552s1c1
Sequence:CCGGGCTCAACTCTGAGGAACGAAACTCGAGTTTCGTTCCTCAGAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1505s1c1
Sequence:CCGGTGGGAGAAAGAATTACACAAACTCGAGTTTGTGTAATTCTTTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-940s1c1
Sequence:CCGGCGTCTCAGATACAAGGACAGACTCGAGTCTGTCCTTGTATCTGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-1382s1c1
Sequence:CCGGGAGGCAAAGAGAGAGGACAAACTCGAGTTTGTCCTCTCTCTTTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174937.1-662s1c1
Sequence:CCGGCCTCGTTTGCTGGCAAATCAACTCGAGTTGATTTGCCAGCAAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2060s21c1
Sequence:CCGGGTGATACGTCGATCCCTTAATCTCGAGATTAAGGGATCGACGTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174937.3-2153s21c1
Sequence:CCGGACGGGAGCCTCTGTAACAATCCTCGAGGATTGTTACAGAGGCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks