EMAIL THIS PAGE TO A FRIEND

TCF12

transcription factor 12

Synonyms: CRS3 HEB HTF4 HsT17266 bHLHb20
UniProtKB ID: Q99081, Q7Z3D9, Q86TC1, Q86VM2
Gene ID:
Human(6938) Summary: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(21406) transcription factor 12
Rat(25720) transcription factor 12
domestic guinea pig(100717047) transcription factor 12
naked mole-rat(101703066) transcription factor 12
cow(509039) transcription factor 12
sheep(101119478) transcription factor 12
Zebrafish(407985) transcription factor 12
Horse(100068843) transcription factor 12
domestic cat(101083852) transcription factor 12
dog(100684199) transcription factor 12
chicken(396334) transcription factor 12
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059281 MISSION® esiRNA esiRNA human TCF12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003205 Rosetta Predictions human pricing
NM_207036 Rosetta Predictions human pricing
NM_207037 Rosetta Predictions human pricing
NM_207038 Rosetta Predictions human pricing
NM_207040 Rosetta Predictions human pricing
NM_013176 Rosetta Predictions rat pricing
XM_579379 Rosetta Predictions rat pricing
NM_011544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222353 predicted 2385
2 SASI_Hs01_00222354 predicted 1927
3 SASI_Hs01_00222355 predicted 2353
4 SASI_Hs01_00222356 predicted 2358
5 SASI_Hs01_00222357 predicted 2413
6 SASI_Hs01_00222358 predicted 1949
7 SASI_Hs01_00222359 predicted 1896
8 SASI_Hs01_00222360 predicted 1962
9 SASI_Hs01_00222361 predicted 1099
10 SASI_Hs01_00222362 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162099 predicted 2455
2 SASI_Hs01_00162100 predicted 1989
3 SASI_Hs01_00162101 predicted 2418
4 SASI_Hs01_00162102 predicted 2415
5 SASI_Hs01_00162103 predicted 2468
6 SASI_Hs01_00162104 predicted 2011
7 SASI_Hs01_00162105 predicted 1959
8 SASI_Hs01_00162106 predicted 2024
9 SASI_Hs01_00162107 predicted 1094
10 SASI_Hs01_00162108 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185128 predicted 2463
2 SASI_Hs01_00185129 predicted 2001
3 SASI_Hs01_00185130 predicted 2426
4 SASI_Hs01_00185131 predicted 2424
5 SASI_Hs01_00185132 predicted 2481
6 SASI_Hs01_00185133 predicted 2021
7 SASI_Hs01_00185134 predicted 1963
8 SASI_Hs01_00185135 predicted 2033
9 SASI_Hs01_00185136 predicted 1105
10 SASI_Hs01_00185137 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066427 predicted 2381
2 SASI_Hs01_00066428 predicted 1919
3 SASI_Hs01_00066429 predicted 2347
4 SASI_Hs01_00066430 predicted 2343
5 SASI_Hs01_00066431 predicted 2398
6 SASI_Hs01_00066432 predicted 1948
7 SASI_Hs01_00066433 predicted 1887
8 SASI_Hs01_00066434 predicted 1959
9 SASI_Hs01_00066435 predicted 1093
10 SASI_Hs01_00066436 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199424 predicted 1653
2 SASI_Hs01_00199425 predicted 1196
3 SASI_Hs01_00199426 predicted 1616
4 SASI_Hs01_00199427 predicted 1620
5 SASI_Hs01_00199428 predicted 1666
6 SASI_Hs01_00199429 predicted 1211
7 SASI_Hs01_00199430 predicted 1154
8 SASI_Hs01_00199431 predicted 1221
9 SASI_Hs01_00199432 predicted 358
10 SASI_Hs01_00199433 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261000 predicted 992
2 SASI_Rn01_00065220 predicted 1627
3 SASI_Rn01_00065221 predicted 397
4 SASI_Rn02_00261001 predicted 692
5 SASI_Rn01_00065222 predicted 573
6 SASI_Rn01_00065223 predicted 1276
7 SASI_Rn01_00065224 predicted 1603
8 SASI_Rn01_00065225 predicted 1011
9 SASI_Rn02_00261002 predicted 2041
10 SASI_Rn01_00065227 predicted 1547
11 SASI_Rn01_00065226 predicted 805
12 SASI_Rn01_00065228 predicted 857
13 SASI_Rn01_00065229 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161564 predicted 1458
2 SASI_Rn01_00161565 predicted 1729
3 SASI_Rn01_00161566 predicted 1575
4 SASI_Rn01_00161567 predicted 831
5 SASI_Rn01_00161568 predicted 224
6 SASI_Rn01_00161569 predicted 1435
7 SASI_Rn01_00161570 predicted 1589
8 SASI_Rn01_00161571 predicted 1804
9 SASI_Rn01_00161572 predicted 283
10 SASI_Rn01_00161573 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172489 predicted 751
2 SASI_Mm02_00320894 predicted 1244
3 SASI_Mm01_00172490 predicted 2210
4 SASI_Mm01_00172491 predicted 2109
5 SASI_Mm01_00172492 predicted 468
6 SASI_Mm01_00172493 predicted 1973
7 SASI_Mm01_00172494 predicted 660
8 SASI_Mm01_00172495 predicted 1073
9 SASI_Mm01_00172498 predicted 1173
10 SASI_Mm02_00320895 predicted 968
11 SASI_Mm01_00172496 predicted 1523
12 SASI_Mm01_00172497 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003205
VALIDATED
TCF12 MISSION shRNA Bacterial Glycerol Stock
transcription factor 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2319s21c1
Sequence:CCGGTACCAACCCTATGGGTCATATCTCGAGATATGACCCATAGGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-3410s21c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1606s21c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1487s21c1
Sequence:CCGGCTCGAATGGAGGATCGTTTAGCTCGAGCTAAACGATCCTCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2055s21c1
Sequence:CCGGCTTACGCGTGCGGGATATTAACTCGAGTTAATATCCCGCACGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1606s1c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1727s1c1
Sequence:CCGGGCAATCATTCAGTCCTGTCTACTCGAGTAGACAGGACTGAATGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-3410s1c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-379s1c1
Sequence:CCGGCCACCTGTTAATAGTGGGAAACTCGAGTTTCCCACTATTAACAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-986s1c1
Sequence:CCGGCCCACAATTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAATTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003205
VALIDATED
TCF12 MISSION shRNA shRNA Plasmid DNA
transcription factor 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2319s21c1
Sequence:CCGGTACCAACCCTATGGGTCATATCTCGAGATATGACCCATAGGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-3410s21c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1606s21c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1487s21c1
Sequence:CCGGCTCGAATGGAGGATCGTTTAGCTCGAGCTAAACGATCCTCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2055s21c1
Sequence:CCGGCTTACGCGTGCGGGATATTAACTCGAGTTAATATCCCGCACGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1606s1c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1727s1c1
Sequence:CCGGGCAATCATTCAGTCCTGTCTACTCGAGTAGACAGGACTGAATGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-3410s1c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-379s1c1
Sequence:CCGGCCACCTGTTAATAGTGGGAAACTCGAGTTTCCCACTATTAACAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-986s1c1
Sequence:CCGGCCCACAATTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAATTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003205
VALIDATED
TCF12 MISSION shRNA Lentiviral Transduction Particles
transcription factor 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2319s21c1
Sequence:CCGGTACCAACCCTATGGGTCATATCTCGAGATATGACCCATAGGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-3410s21c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1606s21c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-1487s21c1
Sequence:CCGGCTCGAATGGAGGATCGTTTAGCTCGAGCTAAACGATCCTCCATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003205.3-2055s21c1
Sequence:CCGGCTTACGCGTGCGGGATATTAACTCGAGTTAATATCCCGCACGCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1606s1c1
Sequence:CCGGCCATCCCATAATGCACCAATTCTCGAGAATTGGTGCATTATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-1727s1c1
Sequence:CCGGGCAATCATTCAGTCCTGTCTACTCGAGTAGACAGGACTGAATGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003205.3-3410s1c1
Sequence:CCGGGCTGTGATTATGGTGAACATACTCGAGTATGTTCACCATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-379s1c1
Sequence:CCGGCCACCTGTTAATAGTGGGAAACTCGAGTTTCCCACTATTAACAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003205.3-986s1c1
Sequence:CCGGCCCACAATTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAATTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011544
VALIDATED
TCF12 MISSION shRNA Bacterial Glycerol Stock
transcription factor 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-1286s21c1
Sequence:CCGGGAAGGCCTTGGCATCTATTTACTCGAGTAAATAGATGCCAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-869s21c1
Sequence:CCGGTGACGATTTCAACCGTGAATCCTCGAGGATTCACGGTTGAAATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1044s21c1
Sequence:CCGGATGTCTCAGTCCAGTAGTTATCTCGAGATAACTACTGGACTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-3150s21c1
Sequence:CCGGGACCATAGCCTAGCTAATATTCTCGAGAATATTAGCTAGGCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1650s21c1
Sequence:CCGGCCATCCCATAATGCATCAATTCTCGAGAATTGATGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-2625s1c1
Sequence:CCGGGCCAGCATTGTTAAAGCTGTTCTCGAGAACAGCTTTAACAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1502s1c1
Sequence:CCGGGCCTTGTTACAAATAGTCGATCTCGAGATCGACTATTTGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1735s1c1
Sequence:CCGGCCTTCATCAGATGACATGAAACTCGAGTTTCATGTCATCTGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-758s1c1
Sequence:CCGGCCCACAGTTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1940s1c1
Sequence:CCGGGCCGAATGTGTCAGCTTCATTCTCGAGAATGAAGCTGACACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011544
VALIDATED
TCF12 MISSION shRNA shRNA Plasmid DNA
transcription factor 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-1286s21c1
Sequence:CCGGGAAGGCCTTGGCATCTATTTACTCGAGTAAATAGATGCCAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-869s21c1
Sequence:CCGGTGACGATTTCAACCGTGAATCCTCGAGGATTCACGGTTGAAATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1044s21c1
Sequence:CCGGATGTCTCAGTCCAGTAGTTATCTCGAGATAACTACTGGACTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-3150s21c1
Sequence:CCGGGACCATAGCCTAGCTAATATTCTCGAGAATATTAGCTAGGCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1650s21c1
Sequence:CCGGCCATCCCATAATGCATCAATTCTCGAGAATTGATGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-2625s1c1
Sequence:CCGGGCCAGCATTGTTAAAGCTGTTCTCGAGAACAGCTTTAACAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1502s1c1
Sequence:CCGGGCCTTGTTACAAATAGTCGATCTCGAGATCGACTATTTGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1735s1c1
Sequence:CCGGCCTTCATCAGATGACATGAAACTCGAGTTTCATGTCATCTGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-758s1c1
Sequence:CCGGCCCACAGTTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1940s1c1
Sequence:CCGGGCCGAATGTGTCAGCTTCATTCTCGAGAATGAAGCTGACACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011544
VALIDATED
TCF12 MISSION shRNA Lentiviral Transduction Particles
transcription factor 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-1286s21c1
Sequence:CCGGGAAGGCCTTGGCATCTATTTACTCGAGTAAATAGATGCCAAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-869s21c1
Sequence:CCGGTGACGATTTCAACCGTGAATCCTCGAGGATTCACGGTTGAAATCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1044s21c1
Sequence:CCGGATGTCTCAGTCCAGTAGTTATCTCGAGATAACTACTGGACTGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011544.3-3150s21c1
Sequence:CCGGGACCATAGCCTAGCTAATATTCTCGAGAATATTAGCTAGGCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011544.3-1650s21c1
Sequence:CCGGCCATCCCATAATGCATCAATTCTCGAGAATTGATGCATTATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-2625s1c1
Sequence:CCGGGCCAGCATTGTTAAAGCTGTTCTCGAGAACAGCTTTAACAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1502s1c1
Sequence:CCGGGCCTTGTTACAAATAGTCGATCTCGAGATCGACTATTTGTAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1735s1c1
Sequence:CCGGCCTTCATCAGATGACATGAAACTCGAGTTTCATGTCATCTGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011544.1-758s1c1
Sequence:CCGGCCCACAGTTCTTCTGACCTTTCTCGAGAAAGGTCAGAAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011544.1-1940s1c1
Sequence:CCGGGCCGAATGTGTCAGCTTCATTCTCGAGAATGAAGCTGACACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks