EMAIL THIS PAGE TO A FRIEND

TCF15

transcription factor 15 (basic helix-loop-helix)

Synonyms: EC2 PARAXIS bHLHa40
UniProtKB ID: Q12870, Q9NQQ1
Gene ID:
Human(6939) Summary: The protein encoded by this gene is found in the nucleus and may be involved in the early transcriptional regulation of patterning of the mesoderm. The encoded basic helix-loop-helix protein requires dimerization with another basic helix-loop-helix protein for efficient DNA binding. [provided by RefSeq, Jul 2008]
Mouse(21407) transcription factor 15
Rat(296272) transcription factor 15
chicken(395788) transcription factor 15 (basic helix-loop-helix)
dog(609667) transcription factor 15 (basic helix-loop-helix)
cow(518491) transcription factor 15 (basic helix-loop-helix)
sheep(101107981) transcription factor 15 (basic helix-loop-helix)
naked mole-rat(101726094) transcription factor 15 (basic helix-loop-helix)
domestic guinea pig(100715168) transcription factor 15 (basic helix-loop-helix)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004609 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073381 MISSION® esiRNA esiRNA targeting mouse Tcf15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004609 Rosetta Predictions human pricing
XM_001061476 Rosetta Predictions rat pricing
XM_230722 Rosetta Predictions rat pricing
NM_009328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235126 predicted 982
2 SASI_Hs01_00235127 predicted 1022
3 SASI_Hs01_00235128 predicted 759
4 SASI_Hs01_00235129 predicted 1171
5 SASI_Hs01_00235130 predicted 1130
6 SASI_Hs01_00235132 predicted 1180
7 SASI_Hs01_00235133 predicted 1164
8 SASI_Hs01_00235134 predicted 1157
9 SASI_Hs02_00337989 predicted 1140
10 SASI_Hs01_00235135 predicted 1176
11 SASI_Hs01_00235131 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300234 predicted 532
2 SASI_Rn02_00300235 predicted 627
3 SASI_Rn02_00300236 predicted 626
4 SASI_Rn02_00300237 predicted 630
5 SASI_Rn02_00300238 predicted 594
6 SASI_Rn02_00300239 predicted 519
7 SASI_Rn02_00300240 predicted 521
8 SASI_Rn02_00300241 predicted 531
9 SASI_Rn02_00300242 predicted 962
10 SASI_Rn02_00300243 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386422 predicted 528
2 SASI_Rn02_00386423 predicted 629
3 SASI_Rn02_00386424 predicted 625
4 SASI_Rn02_00386425 predicted 633
5 SASI_Rn02_00386426 predicted 590
6 SASI_Rn02_00386427 predicted 523
7 SASI_Rn02_00386428 predicted 520
8 SASI_Rn02_00386429 predicted 527
9 SASI_Rn02_00386430 predicted 959
10 SASI_Rn02_00386431 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144344 predicted 307
2 SASI_Mm01_00144345 predicted 481
3 SASI_Mm01_00144347 predicted 593
4 SASI_Mm01_00144348 predicted 315
5 SASI_Mm01_00144349 predicted 339
6 SASI_Mm01_00144346 predicted 402
7 SASI_Mm01_00144350 predicted 584
8 SASI_Mm01_00144351 predicted 251
9 SASI_Mm01_00144352 predicted 478
10 SASI_Mm01_00144353 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009328
TCF15 MISSION shRNA Bacterial Glycerol Stock
transcription factor 15 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-357s1c1
Sequence:CCGGCGTGGACCGAAAGCTGTCTAACTCGAGTTAGACAGCTTTCGGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-527s1c1
Sequence:CCGGCGCGCTCCATCTGCACCTTCTCTCGAGAGAAGGTGCAGATGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009328.1-707s1c1
Sequence:CCGGAGCTGGACAGAGGAGAAGATTCTCGAGAATCTTCTCCTCTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-453s1c1
Sequence:CCGGCGACGACGGGCAGCCGTGTTTCTCGAGAAACACGGCTGCCCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-303s1c1
Sequence:CCGGGCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009328.2-602s21c1
Sequence:CCGGATGAACCTGGATCCCTGGTTTCTCGAGAAACCAGGGATCCAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009328.2-765s21c1
Sequence:CCGGCACAAGGACCCATCTAGCCATCTCGAGATGGCTAGATGGGTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009328
TCF15 MISSION shRNA shRNA Plasmid DNA
transcription factor 15 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-357s1c1
Sequence:CCGGCGTGGACCGAAAGCTGTCTAACTCGAGTTAGACAGCTTTCGGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-527s1c1
Sequence:CCGGCGCGCTCCATCTGCACCTTCTCTCGAGAGAAGGTGCAGATGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009328.1-707s1c1
Sequence:CCGGAGCTGGACAGAGGAGAAGATTCTCGAGAATCTTCTCCTCTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-453s1c1
Sequence:CCGGCGACGACGGGCAGCCGTGTTTCTCGAGAAACACGGCTGCCCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-303s1c1
Sequence:CCGGGCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009328.2-602s21c1
Sequence:CCGGATGAACCTGGATCCCTGGTTTCTCGAGAAACCAGGGATCCAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009328.2-765s21c1
Sequence:CCGGCACAAGGACCCATCTAGCCATCTCGAGATGGCTAGATGGGTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009328
TCF15 MISSION shRNA Lentiviral Transduction Particles
transcription factor 15 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-357s1c1
Sequence:CCGGCGTGGACCGAAAGCTGTCTAACTCGAGTTAGACAGCTTTCGGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-527s1c1
Sequence:CCGGCGCGCTCCATCTGCACCTTCTCTCGAGAGAAGGTGCAGATGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009328.1-707s1c1
Sequence:CCGGAGCTGGACAGAGGAGAAGATTCTCGAGAATCTTCTCCTCTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-453s1c1
Sequence:CCGGCGACGACGGGCAGCCGTGTTTCTCGAGAAACACGGCTGCCCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009328.1-303s1c1
Sequence:CCGGGCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009328.2-602s21c1
Sequence:CCGGATGAACCTGGATCCCTGGTTTCTCGAGAAACCAGGGATCCAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009328.2-765s21c1
Sequence:CCGGCACAAGGACCCATCTAGCCATCTCGAGATGGCTAGATGGGTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004609
TCF15 MISSION shRNA Bacterial Glycerol Stock
transcription factor 15 (basic helix-loop-helix)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-122s1c1
Sequence:CCGGCGACGCGTCGGACCAGTCGTTCTCGAGAACGACTGGTCCGACGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-284s1c1
Sequence:CCGGTCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-62s1c1
Sequence:CCGGGCACGTGCTGTACCCGGACGTCTCGAGACGTCCGGGTACAGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-791s21c1
Sequence:CCGGGAGAGCTGTGAGGATCCATTCCTCGAGGAATGGATCCTCACAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-862s21c1
Sequence:CCGGCAAAGACTGTTGGTGACAGGGCTCGAGCCCTGTCACCAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-886s21c1
Sequence:CCGGGTGTGTATCTGTGCGTGAGTGCTCGAGCACTCACGCACAGATACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-968s21c1
Sequence:CCGGTCGTTCTGAGCTGAGGAGAGTCTCGAGACTCTCCTCAGCTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004609
TCF15 MISSION shRNA shRNA Plasmid DNA
transcription factor 15 (basic helix-loop-helix)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-122s1c1
Sequence:CCGGCGACGCGTCGGACCAGTCGTTCTCGAGAACGACTGGTCCGACGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-284s1c1
Sequence:CCGGTCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-62s1c1
Sequence:CCGGGCACGTGCTGTACCCGGACGTCTCGAGACGTCCGGGTACAGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-791s21c1
Sequence:CCGGGAGAGCTGTGAGGATCCATTCCTCGAGGAATGGATCCTCACAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-862s21c1
Sequence:CCGGCAAAGACTGTTGGTGACAGGGCTCGAGCCCTGTCACCAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-886s21c1
Sequence:CCGGGTGTGTATCTGTGCGTGAGTGCTCGAGCACTCACGCACAGATACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-968s21c1
Sequence:CCGGTCGTTCTGAGCTGAGGAGAGTCTCGAGACTCTCCTCAGCTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004609
TCF15 MISSION shRNA Lentiviral Transduction Particles
transcription factor 15 (basic helix-loop-helix)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-122s1c1
Sequence:CCGGCGACGCGTCGGACCAGTCGTTCTCGAGAACGACTGGTCCGACGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-284s1c1
Sequence:CCGGTCAGAGCGTGAACACGGCCTTCTCGAGAAGGCCGTGTTCACGCTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004609.2-62s1c1
Sequence:CCGGGCACGTGCTGTACCCGGACGTCTCGAGACGTCCGGGTACAGCACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-791s21c1
Sequence:CCGGGAGAGCTGTGAGGATCCATTCCTCGAGGAATGGATCCTCACAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-862s21c1
Sequence:CCGGCAAAGACTGTTGGTGACAGGGCTCGAGCCCTGTCACCAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-886s21c1
Sequence:CCGGGTGTGTATCTGTGCGTGAGTGCTCGAGCACTCACGCACAGATACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004609.3-968s21c1
Sequence:CCGGTCGTTCTGAGCTGAGGAGAGTCTCGAGACTCTCCTCAGCTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks