EMAIL THIS PAGE TO A FRIEND

TCF19

transcription factor 19

Synonyms: SC1 SC1-1
Gene ID:
Mouse(106795) transcription factor 19
Rat(406195) transcription factor 19
domestic guinea pig(100734455) transcription factor 19
naked mole-rat(101722652) transcription factor 19
cow(514216) transcription factor 19
sheep(101108610) transcription factor 19
dog(474835) transcription factor 19
domestic cat(101098458) transcription factor 19
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115381 MISSION® esiRNA esiRNA human TCF19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077511 Rosetta Predictions human pricing
NM_007109 Rosetta Predictions human pricing
NM_213561 Rosetta Predictions rat pricing
NM_025674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312914 predicted 1838
2 SASI_Hs02_00312915 predicted 1742
3 SASI_Hs02_00312916 predicted 1796
4 SASI_Hs02_00312917 predicted 903
5 SASI_Hs02_00312918 predicted 872
6 SASI_Hs02_00312919 predicted 1680
7 SASI_Hs02_00312920 predicted 919
8 SASI_Hs02_00312921 predicted 1655
9 SASI_Hs02_00312922 predicted 1033
10 SASI_Hs02_00312923 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342952 predicted 2089
2 SASI_Hs02_00342953 predicted 1991
3 SASI_Hs02_00342954 predicted 2034
4 SASI_Hs01_00146037 predicted 1151
5 SASI_Hs02_00342955 predicted 1114
6 SASI_Hs02_00342956 predicted 1932
7 SASI_Hs02_00342957 predicted 1164
8 SASI_Hs02_00342958 predicted 1902
9 SASI_Hs02_00342959 predicted 1285
10 SASI_Hs02_00342960 predicted 2042
11 SASI_Hs01_00146033 predicted 751
12 SASI_Hs01_00146034 predicted 237
13 SASI_Hs01_00146035 predicted 663
14 SASI_Hs01_00146036 predicted 683
15 SASI_Hs01_00146038 predicted 234
16 SASI_Hs01_00146039 predicted 295
17 SASI_Hs01_00146040 predicted 306
18 SASI_Hs01_00146041 predicted 779
19 SASI_Hs01_00146042 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033451 predicted 609
2 SASI_Rn01_00033452 predicted 1212
3 SASI_Rn01_00033453 predicted 657
4 SASI_Rn01_00033454 predicted 1020
5 SASI_Rn01_00033455 predicted 1196
6 SASI_Rn01_00033456 predicted 1235
7 SASI_Rn02_00270588 predicted 1209
8 SASI_Rn01_00033457 predicted 357
9 SASI_Rn01_00033458 predicted 609
10 SASI_Rn01_00033459 predicted 1210
11 SASI_Rn01_00033460 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178065 predicted 1267
2 SASI_Mm01_00178066 predicted 511
3 SASI_Mm01_00178067 predicted 1096
4 SASI_Mm01_00178068 predicted 873
5 SASI_Mm01_00178069 predicted 1117
6 SASI_Mm01_00178070 predicted 1019
7 SASI_Mm01_00178071 predicted 1312
8 SASI_Mm01_00178072 predicted 1191
9 SASI_Mm01_00178073 predicted 754
10 SASI_Mm01_00178074 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007109
TCF19 MISSION shRNA Bacterial Glycerol Stock
transcription factor 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1280s21c1
Sequence:CCGGCAAGGCCACACTGATCCTAAACTCGAGTTTAGGATCAGTGTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1426s21c1
Sequence:CCGGCACAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1144s21c1
Sequence:CCGGGAGTCAAGCCTCAGGACTTTGCTCGAGCAAAGTCCTGAGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007109.2-2885s21c1
Sequence:CCGGCGCCCTTTCCTACCTAGATTTCTCGAGAAATCTAGGTAGGAAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1005s21c1
Sequence:CCGGCAAGGTACTTTGGTCAATAATCTCGAGATTATTGACCAAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-234s1c1
Sequence:CCGGCCAAGGTACTTTGGTCAATAACTCGAGTTATTGACCAAAGTACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-751s1c1
Sequence:CCGGCCCAGGAAGAAACTCCGTGTACTCGAGTACACGGAGTTTCTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-517s1c1
Sequence:CCGGACACTGATCCTAAACTCCATACTCGAGTATGGAGTTTAGGATCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-656s1c1
Sequence:CCGGCCCAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-360s1c1
Sequence:CCGGGTTCCAACAAGTACGAGTCAACTCGAGTTGACTCGTACTTGTTGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007109
TCF19 MISSION shRNA shRNA Plasmid DNA
transcription factor 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1280s21c1
Sequence:CCGGCAAGGCCACACTGATCCTAAACTCGAGTTTAGGATCAGTGTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1426s21c1
Sequence:CCGGCACAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1144s21c1
Sequence:CCGGGAGTCAAGCCTCAGGACTTTGCTCGAGCAAAGTCCTGAGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007109.2-2885s21c1
Sequence:CCGGCGCCCTTTCCTACCTAGATTTCTCGAGAAATCTAGGTAGGAAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1005s21c1
Sequence:CCGGCAAGGTACTTTGGTCAATAATCTCGAGATTATTGACCAAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-234s1c1
Sequence:CCGGCCAAGGTACTTTGGTCAATAACTCGAGTTATTGACCAAAGTACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-751s1c1
Sequence:CCGGCCCAGGAAGAAACTCCGTGTACTCGAGTACACGGAGTTTCTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-517s1c1
Sequence:CCGGACACTGATCCTAAACTCCATACTCGAGTATGGAGTTTAGGATCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-656s1c1
Sequence:CCGGCCCAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-360s1c1
Sequence:CCGGGTTCCAACAAGTACGAGTCAACTCGAGTTGACTCGTACTTGTTGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007109
TCF19 MISSION shRNA Lentiviral Transduction Particles
transcription factor 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1280s21c1
Sequence:CCGGCAAGGCCACACTGATCCTAAACTCGAGTTTAGGATCAGTGTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1426s21c1
Sequence:CCGGCACAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1144s21c1
Sequence:CCGGGAGTCAAGCCTCAGGACTTTGCTCGAGCAAAGTCCTGAGGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007109.2-2885s21c1
Sequence:CCGGCGCCCTTTCCTACCTAGATTTCTCGAGAAATCTAGGTAGGAAAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007109.2-1005s21c1
Sequence:CCGGCAAGGTACTTTGGTCAATAATCTCGAGATTATTGACCAAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-234s1c1
Sequence:CCGGCCAAGGTACTTTGGTCAATAACTCGAGTTATTGACCAAAGTACCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-751s1c1
Sequence:CCGGCCCAGGAAGAAACTCCGTGTACTCGAGTACACGGAGTTTCTTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-517s1c1
Sequence:CCGGACACTGATCCTAAACTCCATACTCGAGTATGGAGTTTAGGATCAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-656s1c1
Sequence:CCGGCCCAACGCAATCGGAGGAAATCTCGAGATTTCCTCCGATTGCGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007109.1-360s1c1
Sequence:CCGGGTTCCAACAAGTACGAGTCAACTCGAGTTGACTCGTACTTGTTGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025674
TCF19 MISSION shRNA Bacterial Glycerol Stock
transcription factor 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025674.1-1349s1c1
Sequence:CCGGCCATTCCTAGAAGGTATGGTTCTCGAGAACCATACCTTCTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-593s1c1
Sequence:CCGGCCAAGGGACTTTGGTCAATAACTCGAGTTATTGACCAAAGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-745s1c1
Sequence:CCGGCTCAGGACTTTGCAGCCATAACTCGAGTTATGGCTGCAAAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-735s1c1
Sequence:CCGGCGGGTTAAACCTCAGGACTTTCTCGAGAAAGTCCTGAGGTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-1009s1c1
Sequence:CCGGCCACAAGAAACCGGAGGAAATCTCGAGATTTCCTCCGGTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025674
TCF19 MISSION shRNA shRNA Plasmid DNA
transcription factor 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025674.1-1349s1c1
Sequence:CCGGCCATTCCTAGAAGGTATGGTTCTCGAGAACCATACCTTCTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-593s1c1
Sequence:CCGGCCAAGGGACTTTGGTCAATAACTCGAGTTATTGACCAAAGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-745s1c1
Sequence:CCGGCTCAGGACTTTGCAGCCATAACTCGAGTTATGGCTGCAAAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-735s1c1
Sequence:CCGGCGGGTTAAACCTCAGGACTTTCTCGAGAAAGTCCTGAGGTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-1009s1c1
Sequence:CCGGCCACAAGAAACCGGAGGAAATCTCGAGATTTCCTCCGGTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025674
TCF19 MISSION shRNA Lentiviral Transduction Particles
transcription factor 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025674.1-1349s1c1
Sequence:CCGGCCATTCCTAGAAGGTATGGTTCTCGAGAACCATACCTTCTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-593s1c1
Sequence:CCGGCCAAGGGACTTTGGTCAATAACTCGAGTTATTGACCAAAGTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-745s1c1
Sequence:CCGGCTCAGGACTTTGCAGCCATAACTCGAGTTATGGCTGCAAAGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-735s1c1
Sequence:CCGGCGGGTTAAACCTCAGGACTTTCTCGAGAAAGTCCTGAGGTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025674.1-1009s1c1
Sequence:CCGGCCACAAGAAACCGGAGGAAATCTCGAGATTTCCTCCGGTTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks