EMAIL THIS PAGE TO A FRIEND

TCF20

transcription factor 20 (AR1)

Synonyms: AR1 SPBP TCF-20
UniProtKB ID: Q9UGU0, A9JX12, O14528, Q13078, Q4V353, Q9H4M0
Gene ID:
Human(6942) Summary: This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(21411) transcription factor 20
Rat(366964) transcription factor 20
Zebrafish(100006417) transcription factor 20
chicken(417980) transcription factor 20 (AR1)
domestic cat(101084464) transcription factor 20 (AR1)
Horse(100056129) transcription factor 20 (AR1)
dog(481224) transcription factor 20 (AR1)
cow(523151) transcription factor 20 (AR1)
sheep(101114510) transcription factor 20 (AR1)
naked mole-rat(101721584) transcription factor 20 (AR1)
Domestic Rabbit(100348277) transcription factor 20 (AR1)
domestic guinea pig(100719788) transcription factor 20 (AR1)
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036786 Anti-TCF20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106444 Anti-TCF20 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005650 Rosetta Predictions human pricing
NM_181492 Rosetta Predictions human pricing
NM_001130574 Rosetta Predictions rat pricing
NM_001114140 Rosetta Predictions mouse pricing
NM_013836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225835 predicted 2493
2 SASI_Hs01_00225836 predicted 3640
3 SASI_Hs01_00225837 predicted 1896
4 SASI_Hs01_00225839 predicted 2934
5 SASI_Hs01_00225840 predicted 5023
6 SASI_Hs02_00340013 predicted 3922
7 SASI_Hs01_00225842 predicted 2719
8 SASI_Hs02_00340014 predicted 5367
9 SASI_Hs02_00340015 predicted 2787
10 SASI_Hs02_00340016 predicted 5048
11 SASI_Hs01_00225838 predicted 1539
12 SASI_Hs01_00225841 predicted 4010
13 SASI_Hs01_00225843 predicted 3634
14 SASI_Hs01_00225844 predicted 3229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126855 predicted 2489
2 SASI_Hs01_00126856 predicted 3644
3 SASI_Hs01_00126857 predicted 1893
4 SASI_Hs01_00126859 predicted 2934
5 SASI_Hs01_00126860 predicted 5022
6 SASI_Hs02_00370110 predicted 3919
7 SASI_Hs01_00126862 predicted 2720
8 SASI_Hs02_00370111 predicted 5366
9 SASI_Hs02_00370112 predicted 2792
10 SASI_Hs02_00370113 predicted 5048
11 SASI_Hs01_00126858 predicted 1537
12 SASI_Hs01_00126861 predicted 4005
13 SASI_Hs01_00126863 predicted 3626
14 SASI_Hs01_00126864 predicted 3226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255909 predicted 6020
2 SASI_Rn02_00255910 predicted 399
3 SASI_Rn02_00255911 predicted 3548
4 SASI_Rn02_00255912 predicted 3965
5 SASI_Rn02_00255913 predicted 1486
6 SASI_Rn02_00255914 predicted 1616
7 SASI_Rn02_00255915 predicted 1920
8 SASI_Rn02_00255916 predicted 2700
9 SASI_Rn02_00255917 predicted 5174
10 SASI_Rn02_00255918 predicted 4823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308449 predicted 400
2 SASI_Mm02_00308450 predicted 408
3 SASI_Mm02_00308451 predicted 2206
4 SASI_Mm02_00308452 predicted 3188
5 SASI_Mm02_00308453 predicted 4265
6 SASI_Mm02_00308454 predicted 1719
7 SASI_Mm02_00308455 predicted 2179
8 SASI_Mm02_00308456 predicted 2507
9 SASI_Mm02_00308457 predicted 1906
10 SASI_Mm02_00308458 predicted 4189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322831 predicted 399
2 SASI_Mm01_00147673 predicted 405
3 SASI_Mm01_00147674 predicted 2206
4 SASI_Mm01_00147675 predicted 3194
5 SASI_Mm01_00147677 predicted 4258
6 SASI_Mm01_00147678 predicted 1722
7 SASI_Mm01_00147679 predicted 2185
8 SASI_Mm01_00147680 predicted 2511
9 SASI_Mm01_00147681 predicted 1909
10 SASI_Mm02_00322832 predicted 4188
11 SASI_Mm01_00147672 predicted 4892
12 SASI_Mm01_00147676 predicted 4340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013836
VALIDATED
TCF20 MISSION shRNA Bacterial Glycerol Stock
transcription factor 20 (AR1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-2424s1c1
Sequence:CCGGCCACGAAATGTCAGTGGTTATCTCGAGATAACCACTGACATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-1734s1c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-4800s1c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-3753s1c1
Sequence:CCGGCGCTGTCTCATGTCTAGTGATCTCGAGATCACTAGACATGAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-1349s1c1
Sequence:CCGGCCACCAGAATTTCAGCCCTATCTCGAGATAGGGCTGAAATTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4758s21c1
Sequence:CCGGGTAGCTCCAGTGGGCATATTGCTCGAGCAATATGCCCACTGGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-3543s21c1
Sequence:CCGGCAGCAACAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4800s21c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-1734s21c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013836.3-6472s21c1
Sequence:CCGGTTGTTCCAATGACAATGAAATCTCGAGATTTCATTGTCATTGGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013836
VALIDATED
TCF20 MISSION shRNA shRNA Plasmid DNA
transcription factor 20 (AR1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-2424s1c1
Sequence:CCGGCCACGAAATGTCAGTGGTTATCTCGAGATAACCACTGACATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-1734s1c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-4800s1c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-3753s1c1
Sequence:CCGGCGCTGTCTCATGTCTAGTGATCTCGAGATCACTAGACATGAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-1349s1c1
Sequence:CCGGCCACCAGAATTTCAGCCCTATCTCGAGATAGGGCTGAAATTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4758s21c1
Sequence:CCGGGTAGCTCCAGTGGGCATATTGCTCGAGCAATATGCCCACTGGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-3543s21c1
Sequence:CCGGCAGCAACAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4800s21c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-1734s21c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013836.3-6472s21c1
Sequence:CCGGTTGTTCCAATGACAATGAAATCTCGAGATTTCATTGTCATTGGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013836
VALIDATED
TCF20 MISSION shRNA Lentiviral Transduction Particles
transcription factor 20 (AR1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-2424s1c1
Sequence:CCGGCCACGAAATGTCAGTGGTTATCTCGAGATAACCACTGACATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-1734s1c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-4800s1c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013836.2-3753s1c1
Sequence:CCGGCGCTGTCTCATGTCTAGTGATCTCGAGATCACTAGACATGAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013836.2-1349s1c1
Sequence:CCGGCCACCAGAATTTCAGCCCTATCTCGAGATAGGGCTGAAATTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4758s21c1
Sequence:CCGGGTAGCTCCAGTGGGCATATTGCTCGAGCAATATGCCCACTGGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-3543s21c1
Sequence:CCGGCAGCAACAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-4800s21c1
Sequence:CCGGGCTGAAGAGAAAGAGAACGATCTCGAGATCGTTCTCTTTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013836.3-1734s21c1
Sequence:CCGGCCCTCATCATCATCTAAGAAACTCGAGTTTCTTAGATGATGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013836.3-6472s21c1
Sequence:CCGGTTGTTCCAATGACAATGAAATCTCGAGATTTCATTGTCATTGGAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005650
VALIDATED
TCF20 MISSION shRNA Bacterial Glycerol Stock
transcription factor 20 (AR1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005650.1-7165s1c1
Sequence:CCGGCGTGATTCTTTATGTTGTGTTCTCGAGAACACAACATAAAGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-4276s1c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-5358s1c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-2952s1c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-975s1c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005650.1-5358s21c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-4276s21c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-6464s21c1
Sequence:CCGGTTCCGATGACAAGTGAAATTTCTCGAGAAATTTCACTTGTCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-2952s21c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-975s21c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005650
VALIDATED
TCF20 MISSION shRNA shRNA Plasmid DNA
transcription factor 20 (AR1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005650.1-7165s1c1
Sequence:CCGGCGTGATTCTTTATGTTGTGTTCTCGAGAACACAACATAAAGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-4276s1c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-5358s1c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-2952s1c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-975s1c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005650.1-5358s21c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-4276s21c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-6464s21c1
Sequence:CCGGTTCCGATGACAAGTGAAATTTCTCGAGAAATTTCACTTGTCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-2952s21c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-975s21c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005650
VALIDATED
TCF20 MISSION shRNA Lentiviral Transduction Particles
transcription factor 20 (AR1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005650.1-7165s1c1
Sequence:CCGGCGTGATTCTTTATGTTGTGTTCTCGAGAACACAACATAAAGAATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-4276s1c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-5358s1c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-2952s1c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005650.1-975s1c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005650.1-5358s21c1
Sequence:CCGGGCCACAGAAATGCAGAGCAAACTCGAGTTTGCTCTGCATTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-4276s21c1
Sequence:CCGGCGCTTGATGATATACTGTCTTCTCGAGAAGACAGTATATCATCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-6464s21c1
Sequence:CCGGTTCCGATGACAAGTGAAATTTCTCGAGAAATTTCACTTGTCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-2952s21c1
Sequence:CCGGGCTAGTTTCAACAACAAGAAACTCGAGTTTCTTGTTGTTGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005650.1-975s21c1
Sequence:CCGGGCACAGGCTTATGGAACACAACTCGAGTTGTGTTCCATAAGCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks