EMAIL THIS PAGE TO A FRIEND

TCF21

transcription factor 21

Synonyms: POD1 bHLHa23
UniProtKB ID: O43680, E1P581, O43545, Q6ICV0, Q9BZ14
Gene ID:
Human(6943) Summary: TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21412) transcription factor 21
Rat(252856) transcription factor 21
domestic guinea pig(100719500) transcription factor 21
naked mole-rat(101709994) transcription factor 21
cow(510873) transcription factor 21
sheep(101106947) transcription factor 21
Zebrafish(558148) transcription factor 21
chicken(421697) transcription factor 21
domestic cat(101098226) transcription factor 21
dog(483993) transcription factor 21
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33421 Anti-TCF21 antibody produced in rabbit affinity isolated antibody canine, horse, human, rabbit, bovine, mouse, guinea pig, rat
western blot pricing
SAB2102393 Anti-TCF21 antibody produced in rabbit affinity isolated antibody rabbit, bovine, horse, canine, guinea pig, rat, human, mouse
western blot pricing
HPA013189 Anti-TCF21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021561 MISSION® esiRNA esiRNA human TCF21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003206 Rosetta Predictions human pricing
NM_198392 Rosetta Predictions human pricing
NM_001032397 Rosetta Predictions rat pricing
NM_011545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243739 predicted 526
2 SASI_Hs01_00243740 predicted 545
3 SASI_Hs01_00243741 predicted 522
4 SASI_Hs01_00243742 predicted 542
5 SASI_Hs01_00243743 predicted 522
6 SASI_Hs01_00243744 predicted 522
7 SASI_Hs01_00243745 predicted 513
8 SASI_Hs01_00243746 predicted 547
9 SASI_Hs01_00243747 predicted 526
10 SASI_Hs01_00243748 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144759 predicted 523
2 SASI_Hs01_00144760 predicted 536
3 SASI_Hs01_00144761 predicted 517
4 SASI_Hs01_00144762 predicted 540
5 SASI_Hs01_00144763 predicted 517
6 SASI_Hs01_00144764 predicted 522
7 SASI_Hs01_00144765 predicted 514
8 SASI_Hs01_00144766 predicted 542
9 SASI_Hs01_00144767 predicted 520
10 SASI_Hs01_00144768 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055259 predicted 949
2 SASI_Rn01_00055260 predicted 641
3 SASI_Rn01_00055262 predicted 959
4 SASI_Rn01_00055263 predicted 948
5 SASI_Rn01_00055264 predicted 619
6 SASI_Rn02_00203617 predicted 679
7 SASI_Rn02_00203618 predicted 907
8 SASI_Rn01_00055266 predicted 442
9 SASI_Rn01_00055267 predicted 932
10 SASI_Rn01_00055268 predicted 891
11 SASI_Rn01_00055261 predicted 687
12 SASI_Rn01_00055265 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031944 predicted 677
2 SASI_Mm01_00031945 predicted 649
3 SASI_Mm01_00031946 predicted 598
4 SASI_Mm01_00031947 predicted 448
5 SASI_Mm01_00031948 predicted 673
6 SASI_Mm01_00031949 predicted 635
7 SASI_Mm01_00031950 predicted 594
8 SASI_Mm01_00031951 predicted 731
9 SASI_Mm01_00031952 predicted 663
10 SASI_Mm01_00031953 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003206
TCF21 MISSION shRNA Bacterial Glycerol Stock
transcription factor 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003206.3-394s21c1
Sequence:CCGGGAGAGCTCCAACTGCGAGAATCTCGAGATTCTCGCAGTTGGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1030s21c1
Sequence:CCGGTATTAACTTCTACCGTGAATGCTCGAGCATTCACGGTAGAAGTTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1102s21c1
Sequence:CCGGATAGATAAGAGCCTATCAATGCTCGAGCATTGATAGGCTCTTATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003206.2-973s1c1
Sequence:CCGGCGTTTCCAAACCAGAGGAGATCTCGAGATCTCCTCTGGTTTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-670s1c1
Sequence:CCGGCGACAAATACGAGAACGGGTACTCGAGTACCCGTTCTCGTATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-343s1c1
Sequence:CCGGCAAGGAATTTGTGACTTCCAACTCGAGTTGGAAGTCACAAATTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-685s1c1
Sequence:CCGGCGGGTACATTCACCCGGTCAACTCGAGTTGACCGGGTGAATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-737s1c1
Sequence:CCGGCCCGAGAGTGACCTGAAAGAACTCGAGTTCTTTCAGGTCACTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003206
TCF21 MISSION shRNA shRNA Plasmid DNA
transcription factor 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003206.3-394s21c1
Sequence:CCGGGAGAGCTCCAACTGCGAGAATCTCGAGATTCTCGCAGTTGGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1030s21c1
Sequence:CCGGTATTAACTTCTACCGTGAATGCTCGAGCATTCACGGTAGAAGTTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1102s21c1
Sequence:CCGGATAGATAAGAGCCTATCAATGCTCGAGCATTGATAGGCTCTTATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003206.2-973s1c1
Sequence:CCGGCGTTTCCAAACCAGAGGAGATCTCGAGATCTCCTCTGGTTTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-670s1c1
Sequence:CCGGCGACAAATACGAGAACGGGTACTCGAGTACCCGTTCTCGTATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-343s1c1
Sequence:CCGGCAAGGAATTTGTGACTTCCAACTCGAGTTGGAAGTCACAAATTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-685s1c1
Sequence:CCGGCGGGTACATTCACCCGGTCAACTCGAGTTGACCGGGTGAATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-737s1c1
Sequence:CCGGCCCGAGAGTGACCTGAAAGAACTCGAGTTCTTTCAGGTCACTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003206
TCF21 MISSION shRNA Lentiviral Transduction Particles
transcription factor 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003206.3-394s21c1
Sequence:CCGGGAGAGCTCCAACTGCGAGAATCTCGAGATTCTCGCAGTTGGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1030s21c1
Sequence:CCGGTATTAACTTCTACCGTGAATGCTCGAGCATTCACGGTAGAAGTTAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003206.3-1102s21c1
Sequence:CCGGATAGATAAGAGCCTATCAATGCTCGAGCATTGATAGGCTCTTATCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003206.2-973s1c1
Sequence:CCGGCGTTTCCAAACCAGAGGAGATCTCGAGATCTCCTCTGGTTTGGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-670s1c1
Sequence:CCGGCGACAAATACGAGAACGGGTACTCGAGTACCCGTTCTCGTATTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-343s1c1
Sequence:CCGGCAAGGAATTTGTGACTTCCAACTCGAGTTGGAAGTCACAAATTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-685s1c1
Sequence:CCGGCGGGTACATTCACCCGGTCAACTCGAGTTGACCGGGTGAATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003206.2-737s1c1
Sequence:CCGGCCCGAGAGTGACCTGAAAGAACTCGAGTTCTTTCAGGTCACTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011545
TCF21 MISSION shRNA Bacterial Glycerol Stock
transcription factor 21
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-597s21c1
Sequence:CCGGGTCCAGCTACATCGCTCACTTCTCGAGAAGTGAGCGATGTAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-278s21c1
Sequence:CCGGTGGACTGTGACTCCCTGAAAGCTCGAGCTTTCAGGGAGTCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011545.1-976s21c1
Sequence:CCGGGATTAACTTCTGCCATGAATGCTCGAGCATTCATGGCAGAAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011545.1-1066s1c1
Sequence:CCGGGAGCCTATCAATGTGTATCTTCTCGAGAAGATACACATTGATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-703s1c1
Sequence:CCGGCCAGAGAATGACCTGAAGGAACTCGAGTTCCTTCAGGTCATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-639s1c1
Sequence:CCGGCAAGTACGAGAACGGTTACATCTCGAGATGTAACCGTTCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-651s1c1
Sequence:CCGGCGGTTACATTCACCCAGTCAACTCGAGTTGACTGGGTGAATGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-740s1c1
Sequence:CCGGGCTTGTGTGGAACTACAGCATCTCGAGATGCTGTAGTTCCACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011545
TCF21 MISSION shRNA shRNA Plasmid DNA
transcription factor 21
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-597s21c1
Sequence:CCGGGTCCAGCTACATCGCTCACTTCTCGAGAAGTGAGCGATGTAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-278s21c1
Sequence:CCGGTGGACTGTGACTCCCTGAAAGCTCGAGCTTTCAGGGAGTCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011545.1-976s21c1
Sequence:CCGGGATTAACTTCTGCCATGAATGCTCGAGCATTCATGGCAGAAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011545.1-1066s1c1
Sequence:CCGGGAGCCTATCAATGTGTATCTTCTCGAGAAGATACACATTGATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-703s1c1
Sequence:CCGGCCAGAGAATGACCTGAAGGAACTCGAGTTCCTTCAGGTCATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-639s1c1
Sequence:CCGGCAAGTACGAGAACGGTTACATCTCGAGATGTAACCGTTCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-651s1c1
Sequence:CCGGCGGTTACATTCACCCAGTCAACTCGAGTTGACTGGGTGAATGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-740s1c1
Sequence:CCGGGCTTGTGTGGAACTACAGCATCTCGAGATGCTGTAGTTCCACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011545
TCF21 MISSION shRNA Lentiviral Transduction Particles
transcription factor 21
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-597s21c1
Sequence:CCGGGTCCAGCTACATCGCTCACTTCTCGAGAAGTGAGCGATGTAGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011545.1-278s21c1
Sequence:CCGGTGGACTGTGACTCCCTGAAAGCTCGAGCTTTCAGGGAGTCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011545.1-976s21c1
Sequence:CCGGGATTAACTTCTGCCATGAATGCTCGAGCATTCATGGCAGAAGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011545.1-1066s1c1
Sequence:CCGGGAGCCTATCAATGTGTATCTTCTCGAGAAGATACACATTGATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-703s1c1
Sequence:CCGGCCAGAGAATGACCTGAAGGAACTCGAGTTCCTTCAGGTCATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-639s1c1
Sequence:CCGGCAAGTACGAGAACGGTTACATCTCGAGATGTAACCGTTCTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-651s1c1
Sequence:CCGGCGGTTACATTCACCCAGTCAACTCGAGTTGACTGGGTGAATGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011545.1-740s1c1
Sequence:CCGGGCTTGTGTGGAACTACAGCATCTCGAGATGCTGTAGTTCCACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks