EMAIL THIS PAGE TO A FRIEND

TCF23

transcription factor 23

Synonyms: OUT TCF-23 bHLHa24
UniProtKB ID: Q7RTU1, B2RNZ3
Gene ID:
Human(150921) Summary: The gene encodes a member of the basic helix-loop-helix transcription factor family. Studies of the orthologous gene in mouse have shown the encoded protein does not bind DNA but may negatively regulate other basic helix-loop-helix factors via the formation of a functionally inactive heterodimeric complex. [provided by RefSeq, May 2010]
Mouse(69852) transcription factor 23
Rat(688600) transcription factor 23
Zebrafish(100002924) transcription factor 23
domestic cat(101100803) transcription factor 23
dog(483008) transcription factor 23
cow(616841) transcription factor 23
sheep(101115014) transcription factor 23
naked mole-rat(101708365) transcription factor 23
domestic guinea pig(100722000) transcription factor 23
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175769 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029841 MISSION® esiRNA esiRNA targeting mouse Tcf23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175769 Rosetta Predictions human pricing
XM_001067558 Rosetta Predictions rat pricing
NM_053085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186647 predicted 351
2 SASI_Hs01_00186648 predicted 222
3 SASI_Hs01_00186649 predicted 376
4 SASI_Hs01_00186650 predicted 345
5 SASI_Hs01_00186651 predicted 212
6 SASI_Hs01_00186652 predicted 359
7 SASI_Hs01_00186653 predicted 393
8 SASI_Hs01_00186655 predicted 420
9 SASI_Hs01_00186654 predicted 265
10 SASI_Hs01_00186656 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321392 predicted 655
2 SASI_Rn02_00321393 predicted 719
3 SASI_Rn02_00321394 predicted 300
4 SASI_Rn02_00321395 predicted 738
5 SASI_Rn02_00321396 predicted 245
6 SASI_Rn02_00321397 predicted 542
7 SASI_Rn02_00321398 predicted 597
8 SASI_Rn02_00321399 predicted 783
9 SASI_Rn02_00321400 predicted 541
10 SASI_Rn02_00321401 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093942 predicted 361
2 SASI_Mm01_00093943 predicted 622
3 SASI_Mm01_00093944 predicted 922
4 SASI_Mm01_00093945 predicted 982
5 SASI_Mm02_00337572 predicted 1060
6 SASI_Mm01_00093946 predicted 353
7 SASI_Mm01_00093947 predicted 536
8 SASI_Mm01_00093948 predicted 885
9 SASI_Mm01_00093949 predicted 838
10 SASI_Mm02_00337573 predicted 1182
11 SASI_Mm01_00093950 predicted 919
12 SASI_Mm01_00093951 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053085
TCF23 MISSION shRNA Bacterial Glycerol Stock
transcription factor 23
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053085.1-1536s1c1
Sequence:CCGGCCCAAGATAAAGCAGGTGCATCTCGAGATGCACCTGCTTTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-615s1c1
Sequence:CCGGCCTCGATTCCACCACAGCTATCTCGAGATAGCTGTGGTGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-147s1c1
Sequence:CCGGGCATGGTCATAATAAGGCCAACTCGAGTTGGCCTTATTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-555s1c1
Sequence:CCGGCCCGCTAAAGAAGTGGCCCATCTCGAGATGGGCCACTTCTTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-140s1c1
Sequence:CCGGGAGAAGGGCATGGTCATAATACTCGAGTATTATGACCATGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-678s21c1
Sequence:CCGGAGACTCTGTAGCCGCAGAAAGCTCGAGCTTTCTGCGGCTACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053085.2-886s21c1
Sequence:CCGGGCAGTAATGACATCAGTAATACTCGAGTATTACTGATGTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-731s21c1
Sequence:CCGGGACCACCATGATCATCCTATTCTCGAGAATAGGATGATCATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053085
TCF23 MISSION shRNA shRNA Plasmid DNA
transcription factor 23
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053085.1-1536s1c1
Sequence:CCGGCCCAAGATAAAGCAGGTGCATCTCGAGATGCACCTGCTTTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-615s1c1
Sequence:CCGGCCTCGATTCCACCACAGCTATCTCGAGATAGCTGTGGTGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-147s1c1
Sequence:CCGGGCATGGTCATAATAAGGCCAACTCGAGTTGGCCTTATTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-555s1c1
Sequence:CCGGCCCGCTAAAGAAGTGGCCCATCTCGAGATGGGCCACTTCTTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-140s1c1
Sequence:CCGGGAGAAGGGCATGGTCATAATACTCGAGTATTATGACCATGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-678s21c1
Sequence:CCGGAGACTCTGTAGCCGCAGAAAGCTCGAGCTTTCTGCGGCTACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053085.2-886s21c1
Sequence:CCGGGCAGTAATGACATCAGTAATACTCGAGTATTACTGATGTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-731s21c1
Sequence:CCGGGACCACCATGATCATCCTATTCTCGAGAATAGGATGATCATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053085
TCF23 MISSION shRNA Lentiviral Transduction Particles
transcription factor 23
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053085.1-1536s1c1
Sequence:CCGGCCCAAGATAAAGCAGGTGCATCTCGAGATGCACCTGCTTTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-615s1c1
Sequence:CCGGCCTCGATTCCACCACAGCTATCTCGAGATAGCTGTGGTGGAATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-147s1c1
Sequence:CCGGGCATGGTCATAATAAGGCCAACTCGAGTTGGCCTTATTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-555s1c1
Sequence:CCGGCCCGCTAAAGAAGTGGCCCATCTCGAGATGGGCCACTTCTTTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053085.1-140s1c1
Sequence:CCGGGAGAAGGGCATGGTCATAATACTCGAGTATTATGACCATGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-678s21c1
Sequence:CCGGAGACTCTGTAGCCGCAGAAAGCTCGAGCTTTCTGCGGCTACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053085.2-886s21c1
Sequence:CCGGGCAGTAATGACATCAGTAATACTCGAGTATTACTGATGTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053085.2-731s21c1
Sequence:CCGGGACCACCATGATCATCCTATTCTCGAGAATAGGATGATCATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175769
TCF23 MISSION shRNA Bacterial Glycerol Stock
transcription factor 23
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-458s21c1
Sequence:CCGGCTCTCAAGAAGTGGCCGATGCCTCGAGGCATCGGCCACTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-473s21c1
Sequence:CCGGCGATGCGATCTCGTCTCTATGCTCGAGCATAGAGACGAGATCGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-446s21c1
Sequence:CCGGGCTACTTGCACCCTCTCAAGACTCGAGTCTTGAGAGGGTGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-50s21c1
Sequence:CCGGATAGCCAGACTCAGGCCAAAGCTCGAGCTTTGGCCTGAGTCTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-125s21c1
Sequence:CCGGAGGACCCGTGGGAAGAAAGAACTCGAGTTCTTTCTTCCCACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175769
TCF23 MISSION shRNA shRNA Plasmid DNA
transcription factor 23
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-458s21c1
Sequence:CCGGCTCTCAAGAAGTGGCCGATGCCTCGAGGCATCGGCCACTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-473s21c1
Sequence:CCGGCGATGCGATCTCGTCTCTATGCTCGAGCATAGAGACGAGATCGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-446s21c1
Sequence:CCGGGCTACTTGCACCCTCTCAAGACTCGAGTCTTGAGAGGGTGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-50s21c1
Sequence:CCGGATAGCCAGACTCAGGCCAAAGCTCGAGCTTTGGCCTGAGTCTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-125s21c1
Sequence:CCGGAGGACCCGTGGGAAGAAAGAACTCGAGTTCTTTCTTCCCACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175769
TCF23 MISSION shRNA Lentiviral Transduction Particles
transcription factor 23
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-458s21c1
Sequence:CCGGCTCTCAAGAAGTGGCCGATGCCTCGAGGCATCGGCCACTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-473s21c1
Sequence:CCGGCGATGCGATCTCGTCTCTATGCTCGAGCATAGAGACGAGATCGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-446s21c1
Sequence:CCGGGCTACTTGCACCCTCTCAAGACTCGAGTCTTGAGAGGGTGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-50s21c1
Sequence:CCGGATAGCCAGACTCAGGCCAAAGCTCGAGCTTTGGCCTGAGTCTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175769.1-125s21c1
Sequence:CCGGAGGACCCGTGGGAAGAAAGAACTCGAGTTCTTTCTTCCCACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks