EMAIL THIS PAGE TO A FRIEND

TCF25

transcription factor 25 (basic helix-loop-helix)

Synonyms: Hulp1 NULP1 PRO2620 hKIAA1049
UniProtKB ID: Q9BQ70, Q2MK75, Q9UPV3
Gene ID:
Human(22980) Summary: TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]
Mouse(66855) transcription factor 25 (basic helix-loop-helix)
Rat(292082) transcription factor 25 (basic helix-loop-helix)
Zebrafish(445817) transcription factor 25 (basic helix-loop-helix)
domestic cat(101081943) transcription factor 25 (basic helix-loop-helix)
chicken(425450) transcription factor 25 (basic helix-loop-helix)
dog(608053) transcription factor 25 (basic helix-loop-helix)
cow(618386) transcription factor 25 (basic helix-loop-helix)
sheep(101112506) transcription factor 25 (basic helix-loop-helix)
naked mole-rat(101697061) transcription factor 25 (basic helix-loop-helix)
Domestic Rabbit(100341321) transcription factor 25 (basic helix-loop-helix)
domestic guinea pig(100729019) transcription factor 25 (basic helix-loop-helix)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014972 Rosetta Predictions human pricing
XM_001079503 Rosetta Predictions rat pricing
XM_214707 Rosetta Predictions rat pricing
NM_001037877 Rosetta Predictions mouse pricing
NM_001037878 Rosetta Predictions mouse pricing
NM_025804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141538 predicted 1853
2 SASI_Hs01_00141540 predicted 1590
3 SASI_Hs01_00141542 predicted 1884
4 SASI_Hs01_00141543 predicted 241
5 SASI_Hs01_00141544 predicted 1352
6 SASI_Hs01_00141545 predicted 1892
7 SASI_Hs01_00141546 predicted 2043
8 SASI_Hs01_00141547 predicted 1539
9 SASI_Hs02_00346685 predicted 1605
10 SASI_Hs02_00346686 predicted 1531
11 SASI_Hs01_00141539 predicted 1771
12 SASI_Hs01_00141541 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364546 predicted 2147
2 SASI_Rn02_00364547 predicted 1572
3 SASI_Rn02_00364548 predicted 2225
4 SASI_Rn02_00364549 predicted 1977
5 SASI_Rn02_00364550 predicted 1154
6 SASI_Rn02_00364551 predicted 2247
7 SASI_Rn02_00364552 predicted 1316
8 SASI_Rn02_00364553 predicted 984
9 SASI_Rn02_00364554 predicted 1728
10 SASI_Rn02_00364555 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375535 predicted 2143
2 SASI_Rn02_00375536 predicted 1572
3 SASI_Rn02_00375537 predicted 2226
4 SASI_Rn02_00375538 predicted 1971
5 SASI_Rn02_00375539 predicted 1147
6 SASI_Rn02_00375540 predicted 2250
7 SASI_Rn02_00375541 predicted 1310
8 SASI_Rn02_00375542 predicted 983
9 SASI_Rn02_00375543 predicted 1727
10 SASI_Rn02_00375544 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060514 predicted 1302
2 SASI_Mm01_00060515 predicted 1174
3 SASI_Mm01_00060517 predicted 769
4 SASI_Mm01_00060518 predicted 786
5 SASI_Mm01_00060519 predicted 1082
6 SASI_Mm01_00060520 predicted 759
7 SASI_Mm02_00289480 predicted 920
8 SASI_Mm01_00060521 predicted 1048
9 SASI_Mm01_00060522 predicted 1433
10 SASI_Mm01_00060523 predicted 843
11 SASI_Mm01_00060516 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073651 predicted 1313
2 SASI_Mm01_00073652 predicted 1188
3 SASI_Mm01_00073654 predicted 785
4 SASI_Mm01_00073655 predicted 795
5 SASI_Mm01_00073656 predicted 1087
6 SASI_Mm01_00073657 predicted 769
7 SASI_Mm02_00289481 predicted 938
8 SASI_Mm01_00073658 predicted 1060
9 SASI_Mm01_00073659 predicted 1441
10 SASI_Mm01_00073660 predicted 855
11 SASI_Mm01_00073653 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139317 predicted 1391
2 SASI_Mm01_00139318 predicted 1257
3 SASI_Mm01_00139320 predicted 859
4 SASI_Mm01_00139321 predicted 868
5 SASI_Mm01_00139322 predicted 1164
6 SASI_Mm01_00139323 predicted 837
7 SASI_Mm02_00329048 predicted 1007
8 SASI_Mm01_00139324 predicted 1127
9 SASI_Mm01_00139325 predicted 1515
10 SASI_Mm01_00139326 predicted 925
11 SASI_Mm01_00139319 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014972
TCF25 MISSION shRNA Bacterial Glycerol Stock
transcription factor 25 (basic helix-loop-helix)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1587s21c1
Sequence:CCGGACCTTGGGAGGTCACACTTTCCTCGAGGAAAGTGTGACCTCCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1342s21c1
Sequence:CCGGCTCTGTTCCACTGGCGTATTTCTCGAGAAATACGCCAGTGGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1926s21c1
Sequence:CCGGGGTCACTGTTGCCAAACTATACTCGAGTATAGTTTGGCAACAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-286s1c1
Sequence:CCGGCTGATAAACATTGACGATCTTCTCGAGAAGATCGTCAATGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-276s1c1
Sequence:CCGGCCGCTTCGAGCTGATAAACATCTCGAGATGTTTATCAGCTCGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-828s1c1
Sequence:CCGGCCTCTCCTTCTTTGCGTTTGACTCGAGTCAAACGCAAAGAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-1916s1c1
Sequence:CCGGGAAACACCATTGCTCTCTTCTCTCGAGAGAAGAGAGCAATGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-285s1c1
Sequence:CCGGGCTGATAAACATTGACGATCTCTCGAGAGATCGTCAATGTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014972
TCF25 MISSION shRNA shRNA Plasmid DNA
transcription factor 25 (basic helix-loop-helix)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1587s21c1
Sequence:CCGGACCTTGGGAGGTCACACTTTCCTCGAGGAAAGTGTGACCTCCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1342s21c1
Sequence:CCGGCTCTGTTCCACTGGCGTATTTCTCGAGAAATACGCCAGTGGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1926s21c1
Sequence:CCGGGGTCACTGTTGCCAAACTATACTCGAGTATAGTTTGGCAACAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-286s1c1
Sequence:CCGGCTGATAAACATTGACGATCTTCTCGAGAAGATCGTCAATGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-276s1c1
Sequence:CCGGCCGCTTCGAGCTGATAAACATCTCGAGATGTTTATCAGCTCGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-828s1c1
Sequence:CCGGCCTCTCCTTCTTTGCGTTTGACTCGAGTCAAACGCAAAGAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-1916s1c1
Sequence:CCGGGAAACACCATTGCTCTCTTCTCTCGAGAGAAGAGAGCAATGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-285s1c1
Sequence:CCGGGCTGATAAACATTGACGATCTCTCGAGAGATCGTCAATGTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014972
TCF25 MISSION shRNA Lentiviral Transduction Particles
transcription factor 25 (basic helix-loop-helix)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1587s21c1
Sequence:CCGGACCTTGGGAGGTCACACTTTCCTCGAGGAAAGTGTGACCTCCCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1342s21c1
Sequence:CCGGCTCTGTTCCACTGGCGTATTTCTCGAGAAATACGCCAGTGGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014972.2-1926s21c1
Sequence:CCGGGGTCACTGTTGCCAAACTATACTCGAGTATAGTTTGGCAACAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-286s1c1
Sequence:CCGGCTGATAAACATTGACGATCTTCTCGAGAAGATCGTCAATGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-276s1c1
Sequence:CCGGCCGCTTCGAGCTGATAAACATCTCGAGATGTTTATCAGCTCGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-828s1c1
Sequence:CCGGCCTCTCCTTCTTTGCGTTTGACTCGAGTCAAACGCAAAGAAGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-1916s1c1
Sequence:CCGGGAAACACCATTGCTCTCTTCTCTCGAGAGAAGAGAGCAATGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014972.1-285s1c1
Sequence:CCGGGCTGATAAACATTGACGATCTCTCGAGAGATCGTCAATGTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025804
VALIDATED
TCF25 MISSION shRNA Bacterial Glycerol Stock
transcription factor 25 (basic helix-loop-helix)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025804.2-1301s21c1
Sequence:CCGGGGAACTATGAATACCTGATTCCTCGAGGAATCAGGTATTCATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1648s21c1
Sequence:CCGGTGGAAAGAACCCGCCATTATGCTCGAGCATAATGGCGGGTTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1106s21c1
Sequence:CCGGGAACTTGCAGGCTGGATTATCCTCGAGGATAATCCAGCCTGCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-860s21c1
Sequence:CCGGTCTTTGCATTTGACCATAATGCTCGAGCATTATGGTCAAATGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025804.2-2436s21c1
Sequence:CCGGCATGTCATCTCAACAGCTTTACTCGAGTAAAGCTGTTGAGATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-1030s1c1
Sequence:CCGGCCGGAACTATGAATACCTGATCTCGAGATCAGGTATTCATAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025804.1-2113s1c1
Sequence:CCGGGCCTCTGTCTCCCAAATGTTACTCGAGTAACATTTGGGAGACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-888s1c1
Sequence:CCGGCCCTCTACAAGCAGATGAGTTCTCGAGAACTCATCTGCTTGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025804
VALIDATED
TCF25 MISSION shRNA shRNA Plasmid DNA
transcription factor 25 (basic helix-loop-helix)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025804.2-1301s21c1
Sequence:CCGGGGAACTATGAATACCTGATTCCTCGAGGAATCAGGTATTCATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1648s21c1
Sequence:CCGGTGGAAAGAACCCGCCATTATGCTCGAGCATAATGGCGGGTTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1106s21c1
Sequence:CCGGGAACTTGCAGGCTGGATTATCCTCGAGGATAATCCAGCCTGCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-860s21c1
Sequence:CCGGTCTTTGCATTTGACCATAATGCTCGAGCATTATGGTCAAATGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025804.2-2436s21c1
Sequence:CCGGCATGTCATCTCAACAGCTTTACTCGAGTAAAGCTGTTGAGATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-1030s1c1
Sequence:CCGGCCGGAACTATGAATACCTGATCTCGAGATCAGGTATTCATAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025804.1-2113s1c1
Sequence:CCGGGCCTCTGTCTCCCAAATGTTACTCGAGTAACATTTGGGAGACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-888s1c1
Sequence:CCGGCCCTCTACAAGCAGATGAGTTCTCGAGAACTCATCTGCTTGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025804
VALIDATED
TCF25 MISSION shRNA Lentiviral Transduction Particles
transcription factor 25 (basic helix-loop-helix)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025804.2-1301s21c1
Sequence:CCGGGGAACTATGAATACCTGATTCCTCGAGGAATCAGGTATTCATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1648s21c1
Sequence:CCGGTGGAAAGAACCCGCCATTATGCTCGAGCATAATGGCGGGTTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-1106s21c1
Sequence:CCGGGAACTTGCAGGCTGGATTATCCTCGAGGATAATCCAGCCTGCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025804.2-860s21c1
Sequence:CCGGTCTTTGCATTTGACCATAATGCTCGAGCATTATGGTCAAATGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025804.2-2436s21c1
Sequence:CCGGCATGTCATCTCAACAGCTTTACTCGAGTAAAGCTGTTGAGATGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-1030s1c1
Sequence:CCGGCCGGAACTATGAATACCTGATCTCGAGATCAGGTATTCATAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025804.1-2113s1c1
Sequence:CCGGGCCTCTGTCTCCCAAATGTTACTCGAGTAACATTTGGGAGACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025804.1-888s1c1
Sequence:CCGGCCCTCTACAAGCAGATGAGTTCTCGAGAACTCATCTGCTTGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks