EMAIL THIS PAGE TO A FRIEND

TCF3

transcription factor 3

Synonyms: E2A E47 ITF1 TCF-3 VDIR bHLHb21
Gene ID:
Human(6929) Summary: This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
Mouse(21423) transcription factor 3
Rat(171046) transcription factor 3
domestic guinea pig(100733634) transcription factor 3
naked mole-rat(101725133) transcription factor 3
cow(530616) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
sheep(100913162) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
chicken(395146) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
Horse(100147220) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
domestic cat(101098930) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
dog(485079) transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502929 Anti-E2A antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4301356 Anti-phospho-E2A (pThr355) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry pricing
T8079 Anti-TCF3 (266-280) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV38267 Anti-TCF3 (AB1) antibody produced in rabbit IgG fraction of antiserum human, horse, rabbit, rat, mouse, bovine, canine, guinea pig
western blot pricing
AV100871 Anti-TCF3 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, canine, mouse, human, pig
western blot pricing
HPA049808 Anti-TCF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA062476 Anti-TCF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500371 Anti-TCF3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502930 Anti-TCF3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB2501023 Anti-TCF3/ITF1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
WH0006929M1 Monoclonal Anti-TCF3 antibody produced in mouse clone 5G2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404452 Monoclonal Anti-TCF3, (C-terminal) antibody produced in mouse clone 5G2, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_011548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003200 Rosetta Predictions human pricing
NM_001035237 Rosetta Predictions rat pricing
NM_133524 Rosetta Predictions rat pricing
NM_011548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214771 predicted 2064
2 SASI_Hs01_00214772 predicted 1858
3 SASI_Hs02_00335239 predicted 1149
4 SASI_Hs01_00214774 predicted 854
5 SASI_Hs01_00214775 predicted 882
6 SASI_Hs01_00214776 predicted 280
7 SASI_Hs01_00214777 predicted 1812
8 SASI_Hs01_00214778 predicted 1831
9 SASI_Hs01_00214779 predicted 1825
10 SASI_Hs02_00335240 predicted 819
11 SASI_Hs01_00214770 predicted 1050
12 SASI_Hs01_00214773 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051882 predicted 431
2 SASI_Rn01_00051883 predicted 603
3 SASI_Rn01_00051884 predicted 954
4 SASI_Rn01_00051885 predicted 624
5 SASI_Rn01_00051886 predicted 379
6 SASI_Rn01_00051887 predicted 769
7 SASI_Rn01_00051888 predicted 593
8 SASI_Rn01_00051889 predicted 1407
9 SASI_Rn01_00051890 predicted 1082
10 SASI_Rn01_00051891 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052948 predicted 429
2 SASI_Rn01_00052949 predicted 606
3 SASI_Rn01_00052950 predicted 952
4 SASI_Rn01_00052951 predicted 629
5 SASI_Rn01_00052952 predicted 374
6 SASI_Rn01_00052953 predicted 776
7 SASI_Rn01_00052954 predicted 588
8 SASI_Rn01_00052955 predicted 1410
9 SASI_Rn01_00052956 predicted 1082
10 SASI_Rn01_00052957 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022915 predicted 772
2 SASI_Mm01_00022916 predicted 1566
3 SASI_Mm01_00022917 predicted 2066
4 SASI_Mm01_00022918 predicted 1157
5 SASI_Mm01_00022919 predicted 2337
6 SASI_Mm01_00022920 predicted 1555
7 SASI_Mm01_00022921 predicted 1158
8 SASI_Mm01_00022922 predicted 2286
9 SASI_Mm01_00022923 predicted 373
10 SASI_Mm01_00022924 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003200
VALIDATED
TCF3 MISSION shRNA Bacterial Glycerol Stock
transcription factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003200.1-4026s1c1
Sequence:CCGGCCTGGGAGTTTGATCTCTTAACTCGAGTTAAGAGATCAAACTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1465s1c1
Sequence:CCGGCCCGACTCCTACAGTGGGCTACTCGAGTAGCCCACTGTAGGAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1876s1c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-1053s1c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-288s1c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-325s21c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1090s21c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1227s21c1
Sequence:CCGGACGGCCTGCAGAGTAAGATAGCTCGAGCTATCTTACTCTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-2517s21c1
Sequence:CCGGATTGTGCCTAAGCGAAATATTCTCGAGAATATTTCGCTTAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-1913s21c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003200
VALIDATED
TCF3 MISSION shRNA shRNA Plasmid DNA
transcription factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003200.1-4026s1c1
Sequence:CCGGCCTGGGAGTTTGATCTCTTAACTCGAGTTAAGAGATCAAACTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1465s1c1
Sequence:CCGGCCCGACTCCTACAGTGGGCTACTCGAGTAGCCCACTGTAGGAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1876s1c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-1053s1c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-288s1c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-325s21c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1090s21c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1227s21c1
Sequence:CCGGACGGCCTGCAGAGTAAGATAGCTCGAGCTATCTTACTCTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-2517s21c1
Sequence:CCGGATTGTGCCTAAGCGAAATATTCTCGAGAATATTTCGCTTAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-1913s21c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003200
VALIDATED
TCF3 MISSION shRNA Lentiviral Transduction Particles
transcription factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003200.1-4026s1c1
Sequence:CCGGCCTGGGAGTTTGATCTCTTAACTCGAGTTAAGAGATCAAACTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1465s1c1
Sequence:CCGGCCCGACTCCTACAGTGGGCTACTCGAGTAGCCCACTGTAGGAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003200.1-1876s1c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-1053s1c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003200.1-288s1c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-325s21c1
Sequence:CCGGCAGCCTCTCTTCATCCACATTCTCGAGAATGTGGATGAAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1090s21c1
Sequence:CCGGCCCGGATCACTCAAGCAATAACTCGAGTTATTGCTTGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-1227s21c1
Sequence:CCGGACGGCCTGCAGAGTAAGATAGCTCGAGCTATCTTACTCTGCAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003200.2-2517s21c1
Sequence:CCGGATTGTGCCTAAGCGAAATATTCTCGAGAATATTTCGCTTAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003200.2-1913s21c1
Sequence:CCGGGCCTGTTTGAAACGGCGAGAACTCGAGTTCTCGCCGTTTCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125750
VALIDATED
TCF3 MISSION shRNA Bacterial Glycerol Stock
transcription factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125750.3-2595s1c1
Sequence:CCGGCCTTAACTATGTAAGACGGAACTCGAGTTCCGTCTTACATAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-1406s1c1
Sequence:CCGGCCAGCAATAATTTCTCACCTACTCGAGTAGGTGAGAAATTATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-2060s1c1
Sequence:CCGGGCGACATCAATGAGGCCTTTACTCGAGTAAAGGCCTCATTGATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125750.3-1396s1c1
Sequence:CCGGCCGGATCACTCCAGCAATAATCTCGAGATTATTGCTGGAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-438s1c1
Sequence:CCGGCCTGGACTTCAGCATGATGTTCTCGAGAACATCATGCTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125750
VALIDATED
TCF3 MISSION shRNA shRNA Plasmid DNA
transcription factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125750.3-2595s1c1
Sequence:CCGGCCTTAACTATGTAAGACGGAACTCGAGTTCCGTCTTACATAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-1406s1c1
Sequence:CCGGCCAGCAATAATTTCTCACCTACTCGAGTAGGTGAGAAATTATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-2060s1c1
Sequence:CCGGGCGACATCAATGAGGCCTTTACTCGAGTAAAGGCCTCATTGATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125750.3-1396s1c1
Sequence:CCGGCCGGATCACTCCAGCAATAATCTCGAGATTATTGCTGGAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-438s1c1
Sequence:CCGGCCTGGACTTCAGCATGATGTTCTCGAGAACATCATGCTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125750
VALIDATED
TCF3 MISSION shRNA Lentiviral Transduction Particles
transcription factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125750.3-2595s1c1
Sequence:CCGGCCTTAACTATGTAAGACGGAACTCGAGTTCCGTCTTACATAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-1406s1c1
Sequence:CCGGCCAGCAATAATTTCTCACCTACTCGAGTAGGTGAGAAATTATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-2060s1c1
Sequence:CCGGGCGACATCAATGAGGCCTTTACTCGAGTAAAGGCCTCATTGATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125750.3-1396s1c1
Sequence:CCGGCCGGATCACTCCAGCAATAATCTCGAGATTATTGCTGGAGTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125750.3-438s1c1
Sequence:CCGGCCTGGACTTCAGCATGATGTTCTCGAGAACATCATGCTGAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011548
VALIDATED
TCF3 MISSION shRNA Bacterial Glycerol Stock
transcription factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-553s21c1
Sequence:CCGGTTTGACCCTAGCCGGACATACCTCGAGGTATGTCCGGCTAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2629s21c1
Sequence:CCGGGCACATCGTGCCTAAGCATTTCTCGAGAAATGCTTAGGCACGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1169s21c1
Sequence:CCGGTGCATGGATCTGAGGTTAATGCTCGAGCATTAACCTCAGATCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2059s21c1
Sequence:CCGGCTGCACCTCAAGTCGGATAAGCTCGAGCTTATCCGACTTGAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1362s21c1
Sequence:CCGGCCCGGATCACTCCAGCAATAACTCGAGTTATTGCTGGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011548
VALIDATED
TCF3 MISSION shRNA shRNA Plasmid DNA
transcription factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-553s21c1
Sequence:CCGGTTTGACCCTAGCCGGACATACCTCGAGGTATGTCCGGCTAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2629s21c1
Sequence:CCGGGCACATCGTGCCTAAGCATTTCTCGAGAAATGCTTAGGCACGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1169s21c1
Sequence:CCGGTGCATGGATCTGAGGTTAATGCTCGAGCATTAACCTCAGATCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2059s21c1
Sequence:CCGGCTGCACCTCAAGTCGGATAAGCTCGAGCTTATCCGACTTGAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1362s21c1
Sequence:CCGGCCCGGATCACTCCAGCAATAACTCGAGTTATTGCTGGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011548
VALIDATED
TCF3 MISSION shRNA Lentiviral Transduction Particles
transcription factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-553s21c1
Sequence:CCGGTTTGACCCTAGCCGGACATACCTCGAGGTATGTCCGGCTAGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2629s21c1
Sequence:CCGGGCACATCGTGCCTAAGCATTTCTCGAGAAATGCTTAGGCACGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1169s21c1
Sequence:CCGGTGCATGGATCTGAGGTTAATGCTCGAGCATTAACCTCAGATCCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-2059s21c1
Sequence:CCGGCTGCACCTCAAGTCGGATAAGCTCGAGCTTATCCGACTTGAGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011548.3-1362s21c1
Sequence:CCGGCCCGGATCACTCCAGCAATAACTCGAGTTATTGCTGGAGTGATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks