EMAIL THIS PAGE TO A FRIEND

TCF4

transcription factor 4

Synonyms: E2-2 ITF-2 ITF2 PTHS SEF-2 SEF2 SEF2-1 SEF2-1A SEF2-1B TCF-4 bHLHb19
Gene ID:
Human(6925) Summary: This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Aug 2011]
Mouse(21413) transcription factor 4
Rat(84382) transcription factor 4
Zebrafish(100526651) transcription factor 4
domestic cat(101097354) transcription factor 4
dog(403949) transcription factor 4
cow(534935) transcription factor 4
sheep(101120538) transcription factor 4
naked mole-rat(101707519) transcription factor 4
domestic guinea pig(100732402) transcription factor 4
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083962 Rosetta Predictions human pricing
NM_003199 Rosetta Predictions human pricing
NM_053369 Rosetta Predictions rat pricing
NM_001083967 Rosetta Predictions mouse pricing
NM_013685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317381 predicted 1789
2 SASI_Hs02_00317382 predicted 1761
3 SASI_Hs02_00317383 predicted 1046
4 SASI_Hs02_00317384 predicted 1867
5 SASI_Hs02_00317385 predicted 949
6 SASI_Hs02_00317386 predicted 873
7 SASI_Hs02_00317387 predicted 1763
8 SASI_Hs02_00317388 predicted 988
9 SASI_Hs02_00317389 predicted 896
10 SASI_Hs02_00317390 predicted 1745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037759 predicted 1789
2 SASI_Hs01_00037760 predicted 1757
3 SASI_Hs01_00037761 predicted 1050
4 SASI_Hs01_00037762 predicted 1873
5 SASI_Hs01_00037765 predicted 953
6 SASI_Hs01_00037766 predicted 869
7 SASI_Hs02_00335236 predicted 1762
8 SASI_Hs01_00037768 predicted 996
9 SASI_Hs02_00335237 predicted 894
10 SASI_Hs02_00335238 predicted 1741
11 SASI_Hs01_00037763 predicted 1365
12 SASI_Hs01_00037764 predicted 1115
13 SASI_Hs01_00037767 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265846 predicted 1042
2 SASI_Rn01_00099963 predicted 1721
3 SASI_Rn01_00099964 predicted 1478
4 SASI_Rn01_00099965 predicted 771
5 SASI_Rn01_00099966 predicted 772
6 SASI_Rn01_00099967 predicted 1032
7 SASI_Rn01_00099968 predicted 634
8 SASI_Rn02_00265847 predicted 343
9 SASI_Rn01_00099970 predicted 302
10 SASI_Rn01_00099971 predicted 596
11 SASI_Rn01_00099969 predicted 377
12 SASI_Rn01_00099972 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300185 predicted 673
2 SASI_Mm02_00300186 predicted 1422
3 SASI_Mm02_00300187 predicted 1078
4 SASI_Mm02_00300188 predicted 483
5 SASI_Mm02_00300189 predicted 1544
6 SASI_Mm02_00300190 predicted 1138
7 SASI_Mm02_00300191 predicted 959
8 SASI_Mm02_00300192 predicted 1004
9 SASI_Mm02_00300193 predicted 2099
10 SASI_Mm02_00300194 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134330 predicted 992
2 SASI_Mm02_00322560 predicted 1735
3 SASI_Mm01_00134333 predicted 1394
4 SASI_Mm02_00322561 predicted 796
5 SASI_Mm01_00134334 predicted 1861
6 SASI_Mm01_00134336 predicted 1461
7 SASI_Mm02_00322562 predicted 1272
8 SASI_Mm02_00322563 predicted 1325
9 SASI_Mm02_00322564 predicted 2420
10 SASI_Mm02_00322565 predicted 1569
11 SASI_Mm01_00134331 predicted 2263
12 SASI_Mm01_00134332 predicted 637
13 SASI_Mm01_00134335 predicted 565
14 SASI_Mm01_00134337 predicted 2141
15 SASI_Mm01_00134338 predicted 2137
16 SASI_Mm01_00134339 predicted 2102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013685
VALIDATED
TCF4 MISSION shRNA Bacterial Glycerol Stock
transcription factor 4
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-2414s21c1
Sequence:CCGGGGAGCAGCAAGTTCGAGAAAGCTCGAGCTTTCTCGAACTTGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2186s21c1
Sequence:CCGGTAGGTCAAGATCTAGCAATAACTCGAGTTATTGCTAGATCTTGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2253s21c1
Sequence:CCGGGAACGGAGGATGGCCAATAATCTCGAGATTATTGGCCATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-6641s21c1
Sequence:CCGGTGTTACTTGTGATGCAATTAACTCGAGTTAATTGCATCACAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1657s21c1
Sequence:CCGGCCTCGTCATCTCCCAATTATGCTCGAGCATAATTGGGAGATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2074s21c1
Sequence:CCGGCTGGTAGCTCTGAGATCAAATCTCGAGATTTGATCTCAGAGCTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-2720s21c1
Sequence:CCGGGTTTCAGCATTCCCAATTATCCTCGAGGATAATTGGGAATGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1403s21c1
Sequence:CCGGTCGTAGTGGCACAAACCATTACTCGAGTAATGGTTTGTGCCACTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1450s21c1
Sequence:CCGGCCAACGGAACAGACAGTATAACTCGAGTTATACTGTCTGTTCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-960s1c1
Sequence:CCGGCCCAGTACTATCAGTATTCAACTCGAGTTGAATACTGATAGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013685.1-2266s1c1
Sequence:CCGGCCGAGATATCAACGAGGCTTTCTCGAGAAAGCCTCGTTGATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-1628s1c1
Sequence:CCGGGCCTCGTCATCTCCCAATTATCTCGAGATAATTGGGAGATGACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-3029s1c1
Sequence:CCGGCGTCAGCTAGTGTTTCTAATTCTCGAGAATTAGAAACACTAGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-571s1c1
Sequence:CCGGGCTGAGTGATTTACTGGATTTCTCGAGAAATCCAGTAAATCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013685
VALIDATED
TCF4 MISSION shRNA shRNA Plasmid DNA
transcription factor 4
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-2414s21c1
Sequence:CCGGGGAGCAGCAAGTTCGAGAAAGCTCGAGCTTTCTCGAACTTGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2186s21c1
Sequence:CCGGTAGGTCAAGATCTAGCAATAACTCGAGTTATTGCTAGATCTTGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2253s21c1
Sequence:CCGGGAACGGAGGATGGCCAATAATCTCGAGATTATTGGCCATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-6641s21c1
Sequence:CCGGTGTTACTTGTGATGCAATTAACTCGAGTTAATTGCATCACAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1657s21c1
Sequence:CCGGCCTCGTCATCTCCCAATTATGCTCGAGCATAATTGGGAGATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2074s21c1
Sequence:CCGGCTGGTAGCTCTGAGATCAAATCTCGAGATTTGATCTCAGAGCTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-2720s21c1
Sequence:CCGGGTTTCAGCATTCCCAATTATCCTCGAGGATAATTGGGAATGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1403s21c1
Sequence:CCGGTCGTAGTGGCACAAACCATTACTCGAGTAATGGTTTGTGCCACTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1450s21c1
Sequence:CCGGCCAACGGAACAGACAGTATAACTCGAGTTATACTGTCTGTTCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-960s1c1
Sequence:CCGGCCCAGTACTATCAGTATTCAACTCGAGTTGAATACTGATAGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013685.1-2266s1c1
Sequence:CCGGCCGAGATATCAACGAGGCTTTCTCGAGAAAGCCTCGTTGATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-1628s1c1
Sequence:CCGGGCCTCGTCATCTCCCAATTATCTCGAGATAATTGGGAGATGACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-3029s1c1
Sequence:CCGGCGTCAGCTAGTGTTTCTAATTCTCGAGAATTAGAAACACTAGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-571s1c1
Sequence:CCGGGCTGAGTGATTTACTGGATTTCTCGAGAAATCCAGTAAATCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013685
VALIDATED
TCF4 MISSION shRNA Lentiviral Transduction Particles
transcription factor 4
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-2414s21c1
Sequence:CCGGGGAGCAGCAAGTTCGAGAAAGCTCGAGCTTTCTCGAACTTGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2186s21c1
Sequence:CCGGTAGGTCAAGATCTAGCAATAACTCGAGTTATTGCTAGATCTTGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2253s21c1
Sequence:CCGGGAACGGAGGATGGCCAATAATCTCGAGATTATTGGCCATCCTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-6641s21c1
Sequence:CCGGTGTTACTTGTGATGCAATTAACTCGAGTTAATTGCATCACAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1657s21c1
Sequence:CCGGCCTCGTCATCTCCCAATTATGCTCGAGCATAATTGGGAGATGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013685.2-2074s21c1
Sequence:CCGGCTGGTAGCTCTGAGATCAAATCTCGAGATTTGATCTCAGAGCTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013685.2-2720s21c1
Sequence:CCGGGTTTCAGCATTCCCAATTATCCTCGAGGATAATTGGGAATGCTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1403s21c1
Sequence:CCGGTCGTAGTGGCACAAACCATTACTCGAGTAATGGTTTGTGCCACTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013685.2-1450s21c1
Sequence:CCGGCCAACGGAACAGACAGTATAACTCGAGTTATACTGTCTGTTCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-960s1c1
Sequence:CCGGCCCAGTACTATCAGTATTCAACTCGAGTTGAATACTGATAGTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013685.1-2266s1c1
Sequence:CCGGCCGAGATATCAACGAGGCTTTCTCGAGAAAGCCTCGTTGATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-1628s1c1
Sequence:CCGGGCCTCGTCATCTCCCAATTATCTCGAGATAATTGGGAGATGACGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-3029s1c1
Sequence:CCGGCGTCAGCTAGTGTTTCTAATTCTCGAGAATTAGAAACACTAGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013685.1-571s1c1
Sequence:CCGGGCTGAGTGATTTACTGGATTTCTCGAGAAATCCAGTAAATCACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003199
VALIDATED
TCF4 MISSION shRNA Bacterial Glycerol Stock
transcription factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-1512s21c1
Sequence:CCGGCAACGGGACAGACAGTATAATCTCGAGATTATACTGTCTGTCCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2901s21c1
Sequence:CCGGGAGACTGAACGGCAATCTTTCCTCGAGGAAAGATTGCCGTTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2187s21c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003199.2-1056s21c1
Sequence:CCGGCTATCAGTATTCTAGCAATAACTCGAGTTATTGCTAGAATACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2479s21c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003199.1-1010s1c1
Sequence:CCGGGCAGACATCAATTCCAGTCTTCTCGAGAAGACTGGAATTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1352s1c1
Sequence:CCGGCGAATTGAAGATCGTTTAGAACTCGAGTTCTAAACGATCTTCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1774s1c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-2066s1c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003199
VALIDATED
TCF4 MISSION shRNA shRNA Plasmid DNA
transcription factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-1512s21c1
Sequence:CCGGCAACGGGACAGACAGTATAATCTCGAGATTATACTGTCTGTCCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2901s21c1
Sequence:CCGGGAGACTGAACGGCAATCTTTCCTCGAGGAAAGATTGCCGTTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2187s21c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003199.2-1056s21c1
Sequence:CCGGCTATCAGTATTCTAGCAATAACTCGAGTTATTGCTAGAATACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2479s21c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003199.1-1010s1c1
Sequence:CCGGGCAGACATCAATTCCAGTCTTCTCGAGAAGACTGGAATTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1352s1c1
Sequence:CCGGCGAATTGAAGATCGTTTAGAACTCGAGTTCTAAACGATCTTCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1774s1c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-2066s1c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003199
VALIDATED
TCF4 MISSION shRNA Lentiviral Transduction Particles
transcription factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-1512s21c1
Sequence:CCGGCAACGGGACAGACAGTATAATCTCGAGATTATACTGTCTGTCCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2901s21c1
Sequence:CCGGGAGACTGAACGGCAATCTTTCCTCGAGGAAAGATTGCCGTTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2187s21c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003199.2-1056s21c1
Sequence:CCGGCTATCAGTATTCTAGCAATAACTCGAGTTATTGCTAGAATACTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003199.2-2479s21c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003199.1-1010s1c1
Sequence:CCGGGCAGACATCAATTCCAGTCTTCTCGAGAAGACTGGAATTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1352s1c1
Sequence:CCGGCGAATTGAAGATCGTTTAGAACTCGAGTTCTAAACGATCTTCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-1774s1c1
Sequence:CCGGCACGAAATCTTCGGAGGACAACTCGAGTTGTCCTCCGAAGATTTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003199.1-2066s1c1
Sequence:CCGGGAAAGGAATCTGAATCCGAAACTCGAGTTTCGGATTCAGATTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks