EMAIL THIS PAGE TO A FRIEND

TCF7

transcription factor 7 (T-cell specific, HMG-box)

Synonyms: TCF-1
UniProtKB ID: P36402, B3KSH3, Q86WR9, Q9UKI4
Gene ID:
Human(6932) Summary: The protein encoded by this gene is a transcriptional activator that plays an important role in lymphocyte differentiation. This gene is expressed predominantly in T-cells. The encoded protein can bind an enhancer element and activate the CD3E gene, and it also may repress the CTNNB1 and TCF7L2 genes through a feedback mechanism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(21414) transcription factor 7, T cell specific
Rat(363595) transcription factor 7 (T-cell specific, HMG-box)
domestic guinea pig(100712802) transcription factor 7 (T-cell specific, HMG-box)
naked mole-rat(101707882) transcription factor 7 (T-cell specific, HMG-box)
cow(782690) transcription factor 7 (T-cell specific, HMG-box)
sheep(101101980) transcription factor 7 (T-cell specific, HMG-box)
Zebrafish(497649) transcription factor 7 (T-cell specific, HMG-box)
dog(481506) transcription factor 7 (T-cell specific, HMG-box)
domestic cat(101098768) transcription factor 7 (T-cell specific, HMG-box)
chicken(395229) transcription factor 7 (T-cell specific, HMG-box)
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003202 Rosetta Predictions human pricing
NM_201632 Rosetta Predictions human pricing
NM_201633 Rosetta Predictions human pricing
NM_201634 Rosetta Predictions human pricing
NM_213648 Rosetta Predictions human pricing
XM_001073458 Rosetta Predictions rat pricing
XM_343891 Rosetta Predictions rat pricing
NM_009331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335241 predicted 717
2 SASI_Hs01_00201387 predicted 1016
3 SASI_Hs01_00201388 predicted 1008
4 SASI_Hs01_00201389 predicted 839
5 SASI_Hs01_00201390 predicted 929
6 SASI_Hs01_00201391 predicted 727
7 SASI_Hs01_00201392 predicted 979
8 SASI_Hs01_00201394 predicted 836
9 SASI_Hs01_00201395 predicted 986
10 SASI_Hs01_00201396 predicted 1018
11 SASI_Hs01_00201393 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373146 predicted 259
2 SASI_Hs01_00163335 predicted 551
3 SASI_Hs01_00163336 predicted 542
4 SASI_Hs01_00163337 predicted 375
5 SASI_Hs01_00163338 predicted 471
6 SASI_Hs01_00163339 predicted 265
7 SASI_Hs01_00163340 predicted 515
8 SASI_Hs01_00163342 predicted 369
9 SASI_Hs01_00163343 predicted 518
10 SASI_Hs01_00163344 predicted 548
11 SASI_Hs01_00163341 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373147 predicted 256
2 SASI_Hs01_00037789 predicted 554
3 SASI_Hs01_00037790 predicted 550
4 SASI_Hs01_00037791 predicted 374
5 SASI_Hs01_00037792 predicted 473
6 SASI_Hs01_00037793 predicted 268
7 SASI_Hs01_00037794 predicted 517
8 SASI_Hs01_00037796 predicted 368
9 SASI_Hs01_00037797 predicted 517
10 SASI_Hs01_00037798 predicted 555
11 SASI_Hs01_00037795 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373148 predicted 257
2 SASI_Hs01_00065805 predicted 549
3 SASI_Hs01_00065806 predicted 542
4 SASI_Hs01_00065807 predicted 375
5 SASI_Hs01_00065808 predicted 468
6 SASI_Hs01_00065809 predicted 264
7 SASI_Hs01_00065810 predicted 517
8 SASI_Hs01_00065812 predicted 375
9 SASI_Hs01_00065813 predicted 523
10 SASI_Hs01_00065814 predicted 555
11 SASI_Hs01_00065811 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374324 predicted 381
2 SASI_Hs01_00118606 predicted 673
3 SASI_Hs01_00118607 predicted 664
4 SASI_Hs01_00118608 predicted 501
5 SASI_Hs01_00118609 predicted 589
6 SASI_Hs01_00118610 predicted 393
7 SASI_Hs01_00118611 predicted 638
8 SASI_Hs01_00118613 predicted 494
9 SASI_Hs01_00118614 predicted 644
10 SASI_Hs01_00118615 predicted 674
11 SASI_Hs01_00118612 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342936 predicted 1634
2 SASI_Rn02_00342937 predicted 1377
3 SASI_Rn02_00342938 predicted 1542
4 SASI_Rn02_00342939 predicted 1116
5 SASI_Rn02_00342940 predicted 1106
6 SASI_Rn02_00342941 predicted 1076
7 SASI_Rn02_00342942 predicted 1032
8 SASI_Rn02_00342943 predicted 1027
9 SASI_Rn02_00342944 predicted 1613
10 SASI_Rn02_00342945 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396527 predicted 1632
2 SASI_Rn02_00396528 predicted 1370
3 SASI_Rn02_00396529 predicted 1538
4 SASI_Rn02_00396530 predicted 1111
5 SASI_Rn02_00396531 predicted 1107
6 SASI_Rn02_00396532 predicted 1076
7 SASI_Rn02_00396533 predicted 1024
8 SASI_Rn02_00396534 predicted 1028
9 SASI_Rn02_00396535 predicted 1619
10 SASI_Rn02_00396536 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076272 predicted 584
2 SASI_Mm01_00076273 predicted 1143
3 SASI_Mm01_00076274 predicted 883
4 SASI_Mm01_00076275 predicted 1051
5 SASI_Mm01_00076276 predicted 326
6 SASI_Mm01_00076278 predicted 594
7 SASI_Mm01_00076279 predicted 655
8 SASI_Mm01_00076280 predicted 1131
9 SASI_Mm01_00076281 predicted 540
10 SASI_Mm02_00315890 predicted 1352
11 SASI_Mm01_00076277 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003202
VALIDATED
TCF7 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7 (T-cell specific, HMG-box)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-671s1c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003202.2-1210s1c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-346s1c1
Sequence:CCGGGCTCAAGTCGTCGCTCGTGAACTCGAGTTCACGAGCGACGACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-1330s1c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1330s21c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-671s21c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-842s21c1
Sequence:CCGGCCATCCTTGATGCTAGGTTCTCTCGAGAGAACCTAGCATCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1210s21c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003202
VALIDATED
TCF7 MISSION shRNA shRNA Plasmid DNA
transcription factor 7 (T-cell specific, HMG-box)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-671s1c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003202.2-1210s1c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-346s1c1
Sequence:CCGGGCTCAAGTCGTCGCTCGTGAACTCGAGTTCACGAGCGACGACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-1330s1c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1330s21c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-671s21c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-842s21c1
Sequence:CCGGCCATCCTTGATGCTAGGTTCTCTCGAGAGAACCTAGCATCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1210s21c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003202
VALIDATED
TCF7 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7 (T-cell specific, HMG-box)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-671s1c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003202.2-1210s1c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-346s1c1
Sequence:CCGGGCTCAAGTCGTCGCTCGTGAACTCGAGTTCACGAGCGACGACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003202.2-1330s1c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1330s21c1
Sequence:CCGGCCTTCCGATGACAGTGCTCTACTCGAGTAGAGCACTGTCATCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-671s21c1
Sequence:CCGGCAACTCTCTCTCTACGAACATCTCGAGATGTTCGTAGAGAGAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-842s21c1
Sequence:CCGGCCATCCTTGATGCTAGGTTCTCTCGAGAGAACCTAGCATCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003202.3-1210s21c1
Sequence:CCGGGCGGGACAACTACGGGAAGAACTCGAGTTCTTCCCGTAGTTGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009331
VALIDATED
TCF7 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7 (T-cell specific, HMG-box)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-543s1c1
Sequence:CCGGGCCATATGATAGAAACCTGAACTCGAGTTCAGGTTTCTATCATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-819s1c1
Sequence:CCGGGCGGGATAACTACGGAAAGAACTCGAGTTCTTTCCGTAGTTATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009331.2-1609s1c1
Sequence:CCGGGCCACAAGTCTAAACAATAATCTCGAGATTATTGTTTAGACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-184s1c1
Sequence:CCGGCTTTCTCCACTCTACGAACATCTCGAGATGTTCGTAGAGTGGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-624s1c1
Sequence:CCGGCAATGCGTTCATGCTTTACATCTCGAGATGTAAAGCATGAACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-185s21c1
Sequence:CCGGTTCTCCACTCTACGAACATTTCTCGAGAAATGTTCGTAGAGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1843s21c1
Sequence:CCGGAGTCAATATAGTTGGCCTAAACTCGAGTTTAGGCCAACTATATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-598s21c1
Sequence:CCGGAGAAGCCAGTCATCAAGAAACCTCGAGGTTTCTTGATGACTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-888s21c1
Sequence:CCGGAGAAATGCATTCGGTACTTACCTCGAGGTAAGTACCGAATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-440s21c1
Sequence:CCGGGTTCACCCACCCATCCTTGATCTCGAGATCAAGGATGGGTGGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-620s21c1
Sequence:CCGGCCTCAATGCGTTCATGCTTTACTCGAGTAAAGCATGAACGCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1355s21c1
Sequence:CCGGTTAGATCTATGTAGATGTATCCTCGAGGATACATCTACATAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009331
VALIDATED
TCF7 MISSION shRNA shRNA Plasmid DNA
transcription factor 7 (T-cell specific, HMG-box)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-543s1c1
Sequence:CCGGGCCATATGATAGAAACCTGAACTCGAGTTCAGGTTTCTATCATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-819s1c1
Sequence:CCGGGCGGGATAACTACGGAAAGAACTCGAGTTCTTTCCGTAGTTATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009331.2-1609s1c1
Sequence:CCGGGCCACAAGTCTAAACAATAATCTCGAGATTATTGTTTAGACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-184s1c1
Sequence:CCGGCTTTCTCCACTCTACGAACATCTCGAGATGTTCGTAGAGTGGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-624s1c1
Sequence:CCGGCAATGCGTTCATGCTTTACATCTCGAGATGTAAAGCATGAACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-185s21c1
Sequence:CCGGTTCTCCACTCTACGAACATTTCTCGAGAAATGTTCGTAGAGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1843s21c1
Sequence:CCGGAGTCAATATAGTTGGCCTAAACTCGAGTTTAGGCCAACTATATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-598s21c1
Sequence:CCGGAGAAGCCAGTCATCAAGAAACCTCGAGGTTTCTTGATGACTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-888s21c1
Sequence:CCGGAGAAATGCATTCGGTACTTACCTCGAGGTAAGTACCGAATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-440s21c1
Sequence:CCGGGTTCACCCACCCATCCTTGATCTCGAGATCAAGGATGGGTGGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-620s21c1
Sequence:CCGGCCTCAATGCGTTCATGCTTTACTCGAGTAAAGCATGAACGCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1355s21c1
Sequence:CCGGTTAGATCTATGTAGATGTATCCTCGAGGATACATCTACATAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009331
VALIDATED
TCF7 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7 (T-cell specific, HMG-box)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-543s1c1
Sequence:CCGGGCCATATGATAGAAACCTGAACTCGAGTTCAGGTTTCTATCATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-819s1c1
Sequence:CCGGGCGGGATAACTACGGAAAGAACTCGAGTTCTTTCCGTAGTTATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009331.2-1609s1c1
Sequence:CCGGGCCACAAGTCTAAACAATAATCTCGAGATTATTGTTTAGACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-184s1c1
Sequence:CCGGCTTTCTCCACTCTACGAACATCTCGAGATGTTCGTAGAGTGGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009331.2-624s1c1
Sequence:CCGGCAATGCGTTCATGCTTTACATCTCGAGATGTAAAGCATGAACGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-185s21c1
Sequence:CCGGTTCTCCACTCTACGAACATTTCTCGAGAAATGTTCGTAGAGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1843s21c1
Sequence:CCGGAGTCAATATAGTTGGCCTAAACTCGAGTTTAGGCCAACTATATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-598s21c1
Sequence:CCGGAGAAGCCAGTCATCAAGAAACCTCGAGGTTTCTTGATGACTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-888s21c1
Sequence:CCGGAGAAATGCATTCGGTACTTACCTCGAGGTAAGTACCGAATGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-440s21c1
Sequence:CCGGGTTCACCCACCCATCCTTGATCTCGAGATCAAGGATGGGTGGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009331.3-620s21c1
Sequence:CCGGCCTCAATGCGTTCATGCTTTACTCGAGTAAAGCATGAACGCATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009331.3-1355s21c1
Sequence:CCGGTTAGATCTATGTAGATGTATCCTCGAGGATACATCTACATAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks