EMAIL THIS PAGE TO A FRIEND

TCF7L1

transcription factor 7-like 1 (T-cell specific, HMG-box)

Synonyms: TCF-3 TCF3
UniProtKB ID: Q9HCS4, Q53R97, Q6PD70, Q9NP00
Gene ID:
Human(83439) Summary: This gene encodes a member of the T cell factor/lymphoid enhancer factor family of transcription factors. These transcription factors are activated by beta catenin, mediate the Wnt signaling pathway and are antagonized by the transforming growth factor beta signaling pathway. The encoded protein contains a high mobility group-box DNA binding domain and participates in the regulation of cell cycle genes and cellular senescence. [provided by RefSeq, Nov 2010]
Mouse(21415) transcription factor 7 like 1 (T cell specific, HMG box)
Rat(312451) transcription factor 7-like 1 (T-cell specific, HMG-box)
chicken(395230) transcription factor 7-like 1 (T-cell specific, HMG-box)
dog(612070) transcription factor 7-like 1 (T-cell specific, HMG-box)
domestic cat(101089850) transcription factor 7-like 1 (T-cell specific, HMG-box)
cow(515303) transcription factor 7-like 1 (T-cell specific, HMG-box)
naked mole-rat(101699909) transcription factor 7-like 1 (T-cell specific, HMG-box)
domestic guinea pig(100731379) transcription factor 7-like 1 (T-cell specific, HMG-box)
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031283 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031283 Rosetta Predictions human pricing
NM_001107865 Rosetta Predictions rat pricing
NM_001079822 Rosetta Predictions mouse pricing
NM_009332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098827 predicted 576
2 SASI_Hs01_00098828 predicted 391
3 SASI_Hs01_00098829 predicted 371
4 SASI_Hs01_00098830 predicted 511
5 SASI_Hs01_00098831 predicted 352
6 SASI_Hs01_00098833 predicted 895
7 SASI_Hs02_00358707 predicted 365
8 SASI_Hs01_00098836 predicted 2308
9 SASI_Hs02_00358708 predicted 454
10 SASI_Hs02_00358709 predicted 588
11 SASI_Hs01_00098832 predicted 627
12 SASI_Hs01_00098834 predicted 1105
13 SASI_Hs01_00098835 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233045 predicted 2240
2 SASI_Rn02_00233046 predicted 288
3 SASI_Rn02_00233047 predicted 1184
4 SASI_Rn02_00233048 predicted 1162
5 SASI_Rn02_00233049 predicted 519
6 SASI_Rn02_00233050 predicted 680
7 SASI_Rn02_00233051 predicted 2196
8 SASI_Rn02_00233052 predicted 1023
9 SASI_Rn02_00233053 predicted 1346
10 SASI_Rn02_00233054 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293062 predicted 295
2 SASI_Mm02_00293063 predicted 199
3 SASI_Mm02_00293064 predicted 1213
4 SASI_Mm02_00293065 predicted 1195
5 SASI_Mm02_00293066 predicted 859
6 SASI_Mm02_00293067 predicted 832
7 SASI_Mm02_00293068 predicted 278
8 SASI_Mm02_00293069 predicted 1056
9 SASI_Mm02_00293070 predicted 1763
10 SASI_Mm02_00293071 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129572 predicted 290
2 SASI_Mm01_00129573 predicted 193
3 SASI_Mm01_00129574 predicted 515
4 SASI_Mm01_00129575 predicted 1177
5 SASI_Mm01_00129576 predicted 1152
6 SASI_Mm01_00129577 predicted 811
7 SASI_Mm01_00129578 predicted 283
8 SASI_Mm01_00129579 predicted 671
9 SASI_Mm01_00129580 predicted 429
10 SASI_Mm01_00129581 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009332
TCF7L1 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7-like 1 (T-cell specific, HMG-box)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1906s21c1
Sequence:CCGGGCCTTACCACTGTAGATATAACTCGAGTTATATCTACAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1841s21c1
Sequence:CCGGGGAAGCATTATTGGTCAATATCTCGAGATATTGACCAATAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009332.1-1788s1c1
Sequence:CCGGCGGGACTCCAAGTAGTAATGACTCGAGTCATTACTACTTGGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-509s1c1
Sequence:CCGGCCAGCACACTTGTCCAACAAACTCGAGTTTGTTGGACAAGTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1102s1c1
Sequence:CCGGGAAGGAAAGTGCAGCCATTAACTCGAGTTAATGGCTGCACTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1290s1c1
Sequence:CCGGAGACACAGTCTCAGCAGCAAACTCGAGTTTGCTGCTGAGACTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-431s1c1
Sequence:CCGGCGCACCTACCTACAGATGAAACTCGAGTTTCATCTGTAGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009332
TCF7L1 MISSION shRNA shRNA Plasmid DNA
transcription factor 7-like 1 (T-cell specific, HMG-box)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1906s21c1
Sequence:CCGGGCCTTACCACTGTAGATATAACTCGAGTTATATCTACAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1841s21c1
Sequence:CCGGGGAAGCATTATTGGTCAATATCTCGAGATATTGACCAATAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009332.1-1788s1c1
Sequence:CCGGCGGGACTCCAAGTAGTAATGACTCGAGTCATTACTACTTGGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-509s1c1
Sequence:CCGGCCAGCACACTTGTCCAACAAACTCGAGTTTGTTGGACAAGTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1102s1c1
Sequence:CCGGGAAGGAAAGTGCAGCCATTAACTCGAGTTAATGGCTGCACTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1290s1c1
Sequence:CCGGAGACACAGTCTCAGCAGCAAACTCGAGTTTGCTGCTGAGACTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-431s1c1
Sequence:CCGGCGCACCTACCTACAGATGAAACTCGAGTTTCATCTGTAGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009332
TCF7L1 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7-like 1 (T-cell specific, HMG-box)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1906s21c1
Sequence:CCGGGCCTTACCACTGTAGATATAACTCGAGTTATATCTACAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009332.2-1841s21c1
Sequence:CCGGGGAAGCATTATTGGTCAATATCTCGAGATATTGACCAATAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009332.1-1788s1c1
Sequence:CCGGCGGGACTCCAAGTAGTAATGACTCGAGTCATTACTACTTGGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-509s1c1
Sequence:CCGGCCAGCACACTTGTCCAACAAACTCGAGTTTGTTGGACAAGTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1102s1c1
Sequence:CCGGGAAGGAAAGTGCAGCCATTAACTCGAGTTAATGGCTGCACTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-1290s1c1
Sequence:CCGGAGACACAGTCTCAGCAGCAAACTCGAGTTTGCTGCTGAGACTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009332.1-431s1c1
Sequence:CCGGCGCACCTACCTACAGATGAAACTCGAGTTTCATCTGTAGGTAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031283
VALIDATED
TCF7L1 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7-like 1 (T-cell specific, HMG-box)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-1869s21c1
Sequence:CCGGCATGACTCATTGAGTAGTAATCTCGAGATTACTACTCAATGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-755s21c1
Sequence:CCGGATCCGAGCTGTCACCGTATTACTCGAGTAATACGGTGACAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-587s21c1
Sequence:CCGGTCCAGCACACTTGTCTAATAACTCGAGTTATTAGACAAGTGTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-511s21c1
Sequence:CCGGGCACCTACCTGCAGATGAAATCTCGAGATTTCATCTGCAGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-397s21c1
Sequence:CCGGCTCAGGACAGCGCGTTCTTTACTCGAGTAAAGAACGCGCTGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-1320s1c1
Sequence:CCGGCGGGACAACTATGGTAAGAAACTCGAGTTTCTTACCATAGTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1211s1c1
Sequence:CCGGCCTTGGAAGAAAGTGGCACAACTCGAGTTGTGCCACTTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-716s1c1
Sequence:CCGGGATCGATCCAAAGACAGGAATCTCGAGATTCCTGTCTTTGGATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1183s1c1
Sequence:CCGGTGAAGGAAAGTGCAGCCATTACTCGAGTAATGGCTGCACTTTCCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-588s1c1
Sequence:CCGGCCAGCACACTTGTCTAATAAACTCGAGTTTATTAGACAAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031283
VALIDATED
TCF7L1 MISSION shRNA shRNA Plasmid DNA
transcription factor 7-like 1 (T-cell specific, HMG-box)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-1869s21c1
Sequence:CCGGCATGACTCATTGAGTAGTAATCTCGAGATTACTACTCAATGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-755s21c1
Sequence:CCGGATCCGAGCTGTCACCGTATTACTCGAGTAATACGGTGACAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-587s21c1
Sequence:CCGGTCCAGCACACTTGTCTAATAACTCGAGTTATTAGACAAGTGTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-511s21c1
Sequence:CCGGGCACCTACCTGCAGATGAAATCTCGAGATTTCATCTGCAGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-397s21c1
Sequence:CCGGCTCAGGACAGCGCGTTCTTTACTCGAGTAAAGAACGCGCTGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-1320s1c1
Sequence:CCGGCGGGACAACTATGGTAAGAAACTCGAGTTTCTTACCATAGTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1211s1c1
Sequence:CCGGCCTTGGAAGAAAGTGGCACAACTCGAGTTGTGCCACTTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-716s1c1
Sequence:CCGGGATCGATCCAAAGACAGGAATCTCGAGATTCCTGTCTTTGGATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1183s1c1
Sequence:CCGGTGAAGGAAAGTGCAGCCATTACTCGAGTAATGGCTGCACTTTCCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-588s1c1
Sequence:CCGGCCAGCACACTTGTCTAATAAACTCGAGTTTATTAGACAAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031283
VALIDATED
TCF7L1 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7-like 1 (T-cell specific, HMG-box)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-1869s21c1
Sequence:CCGGCATGACTCATTGAGTAGTAATCTCGAGATTACTACTCAATGAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-755s21c1
Sequence:CCGGATCCGAGCTGTCACCGTATTACTCGAGTAATACGGTGACAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-587s21c1
Sequence:CCGGTCCAGCACACTTGTCTAATAACTCGAGTTATTAGACAAGTGTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-511s21c1
Sequence:CCGGGCACCTACCTGCAGATGAAATCTCGAGATTTCATCTGCAGGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031283.1-397s21c1
Sequence:CCGGCTCAGGACAGCGCGTTCTTTACTCGAGTAAAGAACGCGCTGTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-1320s1c1
Sequence:CCGGCGGGACAACTATGGTAAGAAACTCGAGTTTCTTACCATAGTTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1211s1c1
Sequence:CCGGCCTTGGAAGAAAGTGGCACAACTCGAGTTGTGCCACTTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-716s1c1
Sequence:CCGGGATCGATCCAAAGACAGGAATCTCGAGATTCCTGTCTTTGGATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031283.1-1183s1c1
Sequence:CCGGTGAAGGAAAGTGCAGCCATTACTCGAGTAATGGCTGCACTTTCCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031283.1-588s1c1
Sequence:CCGGCCAGCACACTTGTCTAATAAACTCGAGTTTATTAGACAAGTGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks