EMAIL THIS PAGE TO A FRIEND

TCF7L2

transcription factor 7-like 2 (T-cell specific, HMG-box)

Synonyms: TCF-4 TCF4
Gene ID:
Human(6934) Summary: This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Mouse(21416) transcription factor 7 like 2, T cell specific, HMG box
Rat(679869) transcription factor 7-like 2 (T-cell specific, HMG-box)
Zebrafish(30510) transcription factor 7-like 2 (T-cell specific, HMG-box)
Horse(100049930) transcription factor 7-like 2 (T-cell specific, HMG-box)
domestic cat(101095618) transcription factor 7-like 2 (T-cell specific, HMG-box)
dog(486894) transcription factor 7-like 2 (T-cell specific, HMG-box)
chicken(395508) transcription factor 7-like 2 (T-cell specific, HMG-box)
domestic guinea pig(100715721) transcription factor 7-like 2 (T-cell specific, HMG-box)
naked mole-rat(101710380) transcription factor 7-like 2 (T-cell specific, HMG-box)
cow(540481) transcription factor 7-like 2 (T-cell specific, HMG-box)
sheep(101118068) transcription factor 7-like 2 (T-cell specific, HMG-box)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102396 Anti-TCF7L2 (ab1) antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, pig, human, mouse, rat, bovine
western blot pricing
SAB2102397 Anti-TCF7L2 (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, human, horse, rat, mouse, rabbit, bovine, guinea pig
western blot pricing
SAB2106479 Anti-TCF7L2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human
ELISA, western blot pricing
T5817 Monoclonal Anti-TCF-4 (T-Cell Factor-4) antibody produced in mouse ~1 mg/mL, clone 6H5-3, purified immunoglobulin, buffered aqueous glycerol solution mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
WH0006934M2 Monoclonal Anti-TCF7L2 antibody produced in mouse clone 1B1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409729 Monoclonal Anti-TCF7L2 antibody produced in mouse clone 1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409730 Monoclonal Anti-TCF7L2 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409731 Monoclonal Anti-TCF7L2 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404454 Monoclonal Anti-TCF7L2, (C-terminal) antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030756 Rosetta Predictions human pricing
XM_001054787 Rosetta Predictions rat pricing
XM_001054844 Rosetta Predictions rat pricing
NM_009333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197690 predicted 1379
2 SASI_Hs01_00197691 predicted 731
3 SASI_Hs01_00197692 predicted 1541
4 SASI_Hs01_00197693 predicted 718
5 SASI_Hs01_00197694 predicted 2278
6 SASI_Hs01_00197695 predicted 1351
7 SASI_Hs01_00197696 predicted 1495
8 SASI_Hs01_00197697 predicted 2117
9 SASI_Hs01_00197698 predicted 1236
10 SASI_Hs02_00358275 predicted 1281
11 SASI_Hs01_00197699 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277230 predicted 1101
2 SASI_Rn02_00277231 predicted 1243
3 SASI_Rn02_00277232 predicted 1160
4 SASI_Rn02_00277233 predicted 987
5 SASI_Rn02_00277234 predicted 1561
6 SASI_Rn02_00277235 predicted 1551
7 SASI_Rn02_00277236 predicted 1307
8 SASI_Rn02_00277237 predicted 995
9 SASI_Rn02_00277238 predicted 891
10 SASI_Rn02_00277239 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277475 predicted 1107
2 SASI_Rn02_00277476 predicted 1249
3 SASI_Rn02_00277477 predicted 1161
4 SASI_Rn02_00277478 predicted 989
5 SASI_Rn02_00277479 predicted 1555
6 SASI_Rn02_00277480 predicted 1551
7 SASI_Rn02_00277481 predicted 1309
8 SASI_Rn02_00277482 predicted 990
9 SASI_Rn02_00277483 predicted 895
10 SASI_Rn02_00277484 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142189 predicted 695
2 SASI_Mm02_00315891 predicted 1869
3 SASI_Mm01_00142190 predicted 578
4 SASI_Mm01_00142191 predicted 280
5 SASI_Mm01_00142192 predicted 833
6 SASI_Mm01_00142193 predicted 746
7 SASI_Mm01_00142195 predicted 577
8 SASI_Mm01_00142196 predicted 377
9 SASI_Mm01_00142197 predicted 538
10 SASI_Mm01_00142198 predicted 1040
11 SASI_Mm01_00142194 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030756
VALIDATED
TCF7L2 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7-like 2 (T-cell specific, HMG-box)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-1281s1c2
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-841s1c1
Sequence:CCGGGCCTCTTATCACGTACAGCAACTCGAGTTGCTGTACGTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1281s1c1
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1495s1c1
Sequence:CCGGGCGGGATAACTATGGAAAGAACTCGAGTTCTTTCCATAGTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-683s1c1
Sequence:CCGGCGAACCTATCTCCAGATGAAACTCGAGTTTCATCTGGAGATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-2077s1c1
Sequence:CCGGCGTCACCAAGTCTTTAGAATACTCGAGTATTCTAAAGACTTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-1136s21c1
Sequence:CCGGCTCCGCACCCTCCAGATATATCTCGAGATATATCTGGAGGGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-722s21c1
Sequence:CCGGCCGAAAGTTTCCGAGACAAATCTCGAGATTTGTCTCGGAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1544s21c1
Sequence:CCGGTAGCTGAGTGCACGTTGAAAGCTCGAGCTTTCAACGTGCACTCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2409s21c1
Sequence:CCGGCCATGTGGCTACATTAGTTGACTCGAGTCAACTAATGTAGCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-623s21c1
Sequence:CCGGGGGATTTAGCTGATGTCAAATCTCGAGATTTGACATCAGCTAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-2214s21c1
Sequence:CCGGGTCGACTTCTTCCTTACATTCCTCGAGGAATGTAAGGAAGAAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1615s21c1
Sequence:CCGGAGAGAAGAGCAAGCGAAATACCTCGAGGTATTTCGCTTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1785s21c1
Sequence:CCGGCCTTTCACTTCCTCCGATTACCTCGAGGTAATCGGAGGAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2434s21c1
Sequence:CCGGTATCGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-545s21c1
Sequence:CCGGGCGCCAACGACGAACTGATTTCTCGAGAAATCAGTTCGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030756
VALIDATED
TCF7L2 MISSION shRNA shRNA Plasmid DNA
transcription factor 7-like 2 (T-cell specific, HMG-box)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-1281s1c2
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-841s1c1
Sequence:CCGGGCCTCTTATCACGTACAGCAACTCGAGTTGCTGTACGTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1281s1c1
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1495s1c1
Sequence:CCGGGCGGGATAACTATGGAAAGAACTCGAGTTCTTTCCATAGTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-683s1c1
Sequence:CCGGCGAACCTATCTCCAGATGAAACTCGAGTTTCATCTGGAGATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-2077s1c1
Sequence:CCGGCGTCACCAAGTCTTTAGAATACTCGAGTATTCTAAAGACTTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-1136s21c1
Sequence:CCGGCTCCGCACCCTCCAGATATATCTCGAGATATATCTGGAGGGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-722s21c1
Sequence:CCGGCCGAAAGTTTCCGAGACAAATCTCGAGATTTGTCTCGGAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1544s21c1
Sequence:CCGGTAGCTGAGTGCACGTTGAAAGCTCGAGCTTTCAACGTGCACTCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2409s21c1
Sequence:CCGGCCATGTGGCTACATTAGTTGACTCGAGTCAACTAATGTAGCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-623s21c1
Sequence:CCGGGGGATTTAGCTGATGTCAAATCTCGAGATTTGACATCAGCTAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-2214s21c1
Sequence:CCGGGTCGACTTCTTCCTTACATTCCTCGAGGAATGTAAGGAAGAAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1615s21c1
Sequence:CCGGAGAGAAGAGCAAGCGAAATACCTCGAGGTATTTCGCTTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1785s21c1
Sequence:CCGGCCTTTCACTTCCTCCGATTACCTCGAGGTAATCGGAGGAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2434s21c1
Sequence:CCGGTATCGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-545s21c1
Sequence:CCGGGCGCCAACGACGAACTGATTTCTCGAGAAATCAGTTCGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030756
VALIDATED
TCF7L2 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7-like 2 (T-cell specific, HMG-box)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-1281s1c2
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-841s1c1
Sequence:CCGGGCCTCTTATCACGTACAGCAACTCGAGTTGCTGTACGTGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1281s1c1
Sequence:CCGGCCCACATAAAGAAACCTCTTACTCGAGTAAGAGGTTTCTTTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-1495s1c1
Sequence:CCGGGCGGGATAACTATGGAAAGAACTCGAGTTCTTTCCATAGTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030756.1-683s1c1
Sequence:CCGGCGAACCTATCTCCAGATGAAACTCGAGTTTCATCTGGAGATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030756.1-2077s1c1
Sequence:CCGGCGTCACCAAGTCTTTAGAATACTCGAGTATTCTAAAGACTTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-1136s21c1
Sequence:CCGGCTCCGCACCCTCCAGATATATCTCGAGATATATCTGGAGGGTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-722s21c1
Sequence:CCGGCCGAAAGTTTCCGAGACAAATCTCGAGATTTGTCTCGGAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1544s21c1
Sequence:CCGGTAGCTGAGTGCACGTTGAAAGCTCGAGCTTTCAACGTGCACTCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2409s21c1
Sequence:CCGGCCATGTGGCTACATTAGTTGACTCGAGTCAACTAATGTAGCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-623s21c1
Sequence:CCGGGGGATTTAGCTGATGTCAAATCTCGAGATTTGACATCAGCTAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030756.3-2214s21c1
Sequence:CCGGGTCGACTTCTTCCTTACATTCCTCGAGGAATGTAAGGAAGAAGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1615s21c1
Sequence:CCGGAGAGAAGAGCAAGCGAAATACCTCGAGGTATTTCGCTTGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-1785s21c1
Sequence:CCGGCCTTTCACTTCCTCCGATTACCTCGAGGTAATCGGAGGAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030756.3-2434s21c1
Sequence:CCGGTATCGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030756.3-545s21c1
Sequence:CCGGGCGCCAACGACGAACTGATTTCTCGAGAAATCAGTTCGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009333
VALIDATED
TCF7L2 MISSION shRNA Bacterial Glycerol Stock
transcription factor 7-like 2 (T-cell specific, HMG-box)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009333.2-2617s1c1
Sequence:CCGGCCTTAGCGTAAGCATCTTATACTCGAGTATAAGATGCTTACGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-323s1c1
Sequence:CCGGGCTCCGAAAGTTTCCGAGATACTCGAGTATCTCGGAAACTTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009333.2-891s1c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-1373s1c1
Sequence:CCGGGTTTCCTAAATCCTTGCCTTTCTCGAGAAAGGCAAGGATTTAGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-747s1c1
Sequence:CCGGCCCTCCAGATATCTCTCCATACTCGAGTATGGAGAGATATCTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-800s21c1
Sequence:CCGGCAAGATGGAGGGCTCTTTAAGCTCGAGCTTAAAGAGCCCTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-579s21c1
Sequence:CCGGACGAGCTGATCTCCTTCAAAGCTCGAGCTTTGAAGGAGATCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1569s21c1
Sequence:CCGGTGGCCGAATGCACATTGAAAGCTCGAGCTTTCAATGTGCATTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2368s21c1
Sequence:CCGGCGCCGTGGCTACATGAGTTAACTCGAGTTAACTCATGTAGCCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1312s21c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1713s21c1
Sequence:CCGGGGTCTGCACGGGATAACTATGCTCGAGCATAGTTATCCCGTGCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2393s21c1
Sequence:CCGGTATGGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1172s21c1
Sequence:CCGGCCAGATATCTCTCCATATTACCTCGAGGTAATATGGAGAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009333
VALIDATED
TCF7L2 MISSION shRNA shRNA Plasmid DNA
transcription factor 7-like 2 (T-cell specific, HMG-box)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009333.2-2617s1c1
Sequence:CCGGCCTTAGCGTAAGCATCTTATACTCGAGTATAAGATGCTTACGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-323s1c1
Sequence:CCGGGCTCCGAAAGTTTCCGAGATACTCGAGTATCTCGGAAACTTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009333.2-891s1c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-1373s1c1
Sequence:CCGGGTTTCCTAAATCCTTGCCTTTCTCGAGAAAGGCAAGGATTTAGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-747s1c1
Sequence:CCGGCCCTCCAGATATCTCTCCATACTCGAGTATGGAGAGATATCTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-800s21c1
Sequence:CCGGCAAGATGGAGGGCTCTTTAAGCTCGAGCTTAAAGAGCCCTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-579s21c1
Sequence:CCGGACGAGCTGATCTCCTTCAAAGCTCGAGCTTTGAAGGAGATCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1569s21c1
Sequence:CCGGTGGCCGAATGCACATTGAAAGCTCGAGCTTTCAATGTGCATTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2368s21c1
Sequence:CCGGCGCCGTGGCTACATGAGTTAACTCGAGTTAACTCATGTAGCCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1312s21c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1713s21c1
Sequence:CCGGGGTCTGCACGGGATAACTATGCTCGAGCATAGTTATCCCGTGCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2393s21c1
Sequence:CCGGTATGGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1172s21c1
Sequence:CCGGCCAGATATCTCTCCATATTACCTCGAGGTAATATGGAGAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009333
VALIDATED
TCF7L2 MISSION shRNA Lentiviral Transduction Particles
transcription factor 7-like 2 (T-cell specific, HMG-box)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009333.2-2617s1c1
Sequence:CCGGCCTTAGCGTAAGCATCTTATACTCGAGTATAAGATGCTTACGCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-323s1c1
Sequence:CCGGGCTCCGAAAGTTTCCGAGATACTCGAGTATCTCGGAAACTTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009333.2-891s1c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-1373s1c1
Sequence:CCGGGTTTCCTAAATCCTTGCCTTTCTCGAGAAAGGCAAGGATTTAGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009333.2-747s1c1
Sequence:CCGGCCCTCCAGATATCTCTCCATACTCGAGTATGGAGAGATATCTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-800s21c1
Sequence:CCGGCAAGATGGAGGGCTCTTTAAGCTCGAGCTTAAAGAGCCCTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-579s21c1
Sequence:CCGGACGAGCTGATCTCCTTCAAAGCTCGAGCTTTGAAGGAGATCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1569s21c1
Sequence:CCGGTGGCCGAATGCACATTGAAAGCTCGAGCTTTCAATGTGCATTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2368s21c1
Sequence:CCGGCGCCGTGGCTACATGAGTTAACTCGAGTTAACTCATGTAGCCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1312s21c1
Sequence:CCGGGCTGACAGTCAACGCATCTATCTCGAGATAGATGCGTTGACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1713s21c1
Sequence:CCGGGGTCTGCACGGGATAACTATGCTCGAGCATAGTTATCCCGTGCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009333.3-2393s21c1
Sequence:CCGGTATGGAGTTCATTGGTCAATACTCGAGTATTGACCAATGAACTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009333.3-1172s21c1
Sequence:CCGGCCAGATATCTCTCCATATTACCTCGAGGTAATATGGAGAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks