EMAIL THIS PAGE TO A FRIEND

TCFL5

transcription factor-like 5 (basic helix-loop-helix)

Synonyms: CHA E2BP-1 Figlb bHLHe82
UniProtKB ID: Q9UL49, O94771, Q9BYW0
Gene ID:
Mouse(277353) transcription factor-like 5 (basic helix-loop-helix)
Rat(311715) transcription factor-like 5 (basic helix-loop-helix)
cow(513750) transcription factor-like 5 (basic helix-loop-helix)
sheep(101119924) transcription factor-like 5 (basic helix-loop-helix)
naked mole-rat(101707900) transcription factor-like 5 (basic helix-loop-helix)
domestic guinea pig(100718273) transcription factor-like 5 (basic helix-loop-helix)
chicken(771446) transcription factor-like 5 (basic helix-loop-helix)
domestic cat(101081622) transcription factor-like 5 (basic helix-loop-helix)
dog(612441) transcription factor-like 5 (basic helix-loop-helix)
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006602 Rosetta Predictions human pricing
XM_001058977 Rosetta Predictions rat pricing
XM_230965 Rosetta Predictions rat pricing
NM_178254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227649 predicted 1578
2 SASI_Hs01_00227650 predicted 1335
3 SASI_Hs01_00227651 predicted 1346
4 SASI_Hs01_00227652 predicted 1809
5 SASI_Hs01_00227653 predicted 1001
6 SASI_Hs01_00227654 predicted 1384
7 SASI_Hs01_00227655 predicted 1773
8 SASI_Hs01_00227656 predicted 1701
9 SASI_Hs01_00227657 predicted 1779
10 SASI_Hs01_00227658 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291486 predicted 1139
2 SASI_Rn02_00291487 predicted 709
3 SASI_Rn02_00291488 predicted 871
4 SASI_Rn02_00291489 predicted 724
5 SASI_Rn02_00291490 predicted 1380
6 SASI_Rn02_00291491 predicted 936
7 SASI_Rn02_00291492 predicted 822
8 SASI_Rn02_00291493 predicted 885
9 SASI_Rn02_00291494 predicted 1194
10 SASI_Rn02_00291495 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160599 predicted 723
2 SASI_Rn01_00160600 predicted 611
3 SASI_Rn01_00160601 predicted 858
4 SASI_Rn01_00160602 predicted 730
5 SASI_Rn01_00160603 predicted 916
6 SASI_Rn01_00160604 predicted 925
7 SASI_Rn01_00160605 predicted 800
8 SASI_Rn01_00160606 predicted 861
9 SASI_Rn01_00160607 predicted 612
10 SASI_Rn01_00160608 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157281 predicted 848
2 SASI_Mm01_00157282 predicted 730
3 SASI_Mm01_00157283 predicted 1091
4 SASI_Mm01_00157284 predicted 859
5 SASI_Mm01_00157285 predicted 947
6 SASI_Mm01_00157286 predicted 904
7 SASI_Mm01_00157287 predicted 1345
8 SASI_Mm01_00157288 predicted 860
9 SASI_Mm01_00157289 predicted 1167
10 SASI_Mm01_00157290 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006602
VALIDATED
TCFL5 MISSION shRNA Bacterial Glycerol Stock
transcription factor-like 5 (basic helix-loop-helix)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-757s21c1
Sequence:CCGGCGACATCCATCTGAACTAATGCTCGAGCATTAGTTCAGATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1450s21c1
Sequence:CCGGAGACATGGAGATTCTCTTAAACTCGAGTTTAAGAGAATCTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006602.2-1994s21c1
Sequence:CCGGTAGCAATTGGAACAAGTTAAACTCGAGTTTAACTTGTTCCAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1060s21c1
Sequence:CCGGCCTGAGCAAGTTTGGATTAAACTCGAGTTTAATCCAAACTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1095s1c1
Sequence:CCGGGCTATGCAAACAAGCACTGAACTCGAGTTCAGTGCTTGTTTGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-852s1c1
Sequence:CCGGGCAATTTACATACCCACTGTTCTCGAGAACAGTGGGTATGTAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1341s1c1
Sequence:CCGGCCGCATTTGCTGTGATGAGTTCTCGAGAACTCATCACAGCAAATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006602.2-1771s1c1
Sequence:CCGGCGCAAATGCTTATCCATGAATCTCGAGATTCATGGATAAGCATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1018s1c1
Sequence:CCGGGAATCCACTAAACAGACGTTACTCGAGTAACGTCTGTTTAGTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006602
VALIDATED
TCFL5 MISSION shRNA shRNA Plasmid DNA
transcription factor-like 5 (basic helix-loop-helix)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-757s21c1
Sequence:CCGGCGACATCCATCTGAACTAATGCTCGAGCATTAGTTCAGATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1450s21c1
Sequence:CCGGAGACATGGAGATTCTCTTAAACTCGAGTTTAAGAGAATCTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006602.2-1994s21c1
Sequence:CCGGTAGCAATTGGAACAAGTTAAACTCGAGTTTAACTTGTTCCAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1060s21c1
Sequence:CCGGCCTGAGCAAGTTTGGATTAAACTCGAGTTTAATCCAAACTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1095s1c1
Sequence:CCGGGCTATGCAAACAAGCACTGAACTCGAGTTCAGTGCTTGTTTGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-852s1c1
Sequence:CCGGGCAATTTACATACCCACTGTTCTCGAGAACAGTGGGTATGTAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1341s1c1
Sequence:CCGGCCGCATTTGCTGTGATGAGTTCTCGAGAACTCATCACAGCAAATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006602.2-1771s1c1
Sequence:CCGGCGCAAATGCTTATCCATGAATCTCGAGATTCATGGATAAGCATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1018s1c1
Sequence:CCGGGAATCCACTAAACAGACGTTACTCGAGTAACGTCTGTTTAGTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006602
VALIDATED
TCFL5 MISSION shRNA Lentiviral Transduction Particles
transcription factor-like 5 (basic helix-loop-helix)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-757s21c1
Sequence:CCGGCGACATCCATCTGAACTAATGCTCGAGCATTAGTTCAGATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1450s21c1
Sequence:CCGGAGACATGGAGATTCTCTTAAACTCGAGTTTAAGAGAATCTCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006602.2-1994s21c1
Sequence:CCGGTAGCAATTGGAACAAGTTAAACTCGAGTTTAACTTGTTCCAATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006602.2-1060s21c1
Sequence:CCGGCCTGAGCAAGTTTGGATTAAACTCGAGTTTAATCCAAACTTGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1095s1c1
Sequence:CCGGGCTATGCAAACAAGCACTGAACTCGAGTTCAGTGCTTGTTTGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-852s1c1
Sequence:CCGGGCAATTTACATACCCACTGTTCTCGAGAACAGTGGGTATGTAAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1341s1c1
Sequence:CCGGCCGCATTTGCTGTGATGAGTTCTCGAGAACTCATCACAGCAAATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006602.2-1771s1c1
Sequence:CCGGCGCAAATGCTTATCCATGAATCTCGAGATTCATGGATAAGCATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006602.2-1018s1c1
Sequence:CCGGGAATCCACTAAACAGACGTTACTCGAGTAACGTCTGTTTAGTGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178254
TCFL5 MISSION shRNA Bacterial Glycerol Stock
transcription factor-like 5 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-1774s21c1
Sequence:CCGGGATGAAGACATCTTGATAATTCTCGAGAATTATCAAGATGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-2026s21c1
Sequence:CCGGCAGTCTCATGGTACTCTATTGCTCGAGCAATAGAGTACCATGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178254.2-1612s1c1
Sequence:CCGGCGACACCATCATGTGTTCTTACTCGAGTAAGAACACATGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-687s1c1
Sequence:CCGGCGCAGAGTTCTAGTAACTCATCTCGAGATGAGTTACTAGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-776s1c1
Sequence:CCGGCAAGAGATTGAGTCCACCAAACTCGAGTTTGGTGGACTCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-836s1c1
Sequence:CCGGGTTTGGATTAAAGTGGGAGAACTCGAGTTCTCCCACTTTAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-1158s1c1
Sequence:CCGGCGGAGACAGATAAAGCAACAACTCGAGTTGTTGCTTTATCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178254
TCFL5 MISSION shRNA shRNA Plasmid DNA
transcription factor-like 5 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-1774s21c1
Sequence:CCGGGATGAAGACATCTTGATAATTCTCGAGAATTATCAAGATGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-2026s21c1
Sequence:CCGGCAGTCTCATGGTACTCTATTGCTCGAGCAATAGAGTACCATGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178254.2-1612s1c1
Sequence:CCGGCGACACCATCATGTGTTCTTACTCGAGTAAGAACACATGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-687s1c1
Sequence:CCGGCGCAGAGTTCTAGTAACTCATCTCGAGATGAGTTACTAGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-776s1c1
Sequence:CCGGCAAGAGATTGAGTCCACCAAACTCGAGTTTGGTGGACTCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-836s1c1
Sequence:CCGGGTTTGGATTAAAGTGGGAGAACTCGAGTTCTCCCACTTTAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-1158s1c1
Sequence:CCGGCGGAGACAGATAAAGCAACAACTCGAGTTGTTGCTTTATCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178254
TCFL5 MISSION shRNA Lentiviral Transduction Particles
transcription factor-like 5 (basic helix-loop-helix)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-1774s21c1
Sequence:CCGGGATGAAGACATCTTGATAATTCTCGAGAATTATCAAGATGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178254.3-2026s21c1
Sequence:CCGGCAGTCTCATGGTACTCTATTGCTCGAGCAATAGAGTACCATGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178254.2-1612s1c1
Sequence:CCGGCGACACCATCATGTGTTCTTACTCGAGTAAGAACACATGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-687s1c1
Sequence:CCGGCGCAGAGTTCTAGTAACTCATCTCGAGATGAGTTACTAGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-776s1c1
Sequence:CCGGCAAGAGATTGAGTCCACCAAACTCGAGTTTGGTGGACTCAATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-836s1c1
Sequence:CCGGGTTTGGATTAAAGTGGGAGAACTCGAGTTCTCCCACTTTAATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178254.2-1158s1c1
Sequence:CCGGCGGAGACAGATAAAGCAACAACTCGAGTTGTTGCTTTATCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks