EMAIL THIS PAGE TO A FRIEND

TCHH

trichohyalin

Synonyms: THH THL TRHY
UniProtKB ID: Q07283, Q5VUI3
Gene ID:
Human(7062) Summary: Trichohyalin confers mechanical strength to the hair follicle inner root sheath and to other toughened epithelial tissues, such as the hard palate and filiform ridges of the tongue, by forming multiple complex crosslinks with itself and with other structural proteins (Steinert et al., 2003 [PubMed 12853460]
Mouse(99681) trichohyalin
Rat(310588) trichohyalin
dog(483207) uncharacterized LOC483207
cow(613296) trichohyalin
sheep(101120969) trichohyalin
cow(280940) trichohyalin
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU214561 MISSION® esiRNA esiRNA targeting mouse Tchh mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007113 Rosetta Predictions human pricing
XM_928573 Rosetta Predictions human pricing
XM_001054694 Rosetta Predictions rat pricing
XM_227373 Rosetta Predictions rat pricing
XM_001000857 Rosetta Predictions mouse pricing
XM_904350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342974 predicted 320
2 SASI_Hs02_00342975 predicted 213
3 SASI_Hs02_00342976 predicted 5572
4 SASI_Hs02_00342977 predicted 5829
5 SASI_Hs02_00342978 predicted 5563
6 SASI_Hs02_00342979 predicted 5538
7 SASI_Hs02_00342980 predicted 3991
8 SASI_Hs02_00342981 predicted 5780
9 SASI_Hs02_00342982 predicted 5807
10 SASI_Hs02_00342983 predicted 4741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249639 predicted 328
2 SASI_Hs01_00249640 predicted 212
3 SASI_Hs01_00249641 predicted 5579
4 SASI_Hs01_00249642 predicted 5829
5 SASI_Hs01_00249643 predicted 384
6 SASI_Hs01_00249644 predicted 5560
7 SASI_Hs01_00249645 predicted 5546
8 SASI_Hs01_00249646 predicted 3994
9 SASI_Hs01_00249647 predicted 5784
10 SASI_Hs01_00249648 predicted 5810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276859 predicted 2403
2 SASI_Rn02_00276860 predicted 4596
3 SASI_Rn02_00276861 predicted 2124
4 SASI_Rn02_00276862 predicted 2462
5 SASI_Rn02_00276863 predicted 4626
6 SASI_Rn02_00276864 predicted 4655
7 SASI_Rn02_00276865 predicted 3960
8 SASI_Rn02_00276866 predicted 3586
9 SASI_Rn02_00276867 predicted 4603
10 SASI_Rn02_00276868 predicted 3451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384341 predicted 213
2 SASI_Rn02_00384342 predicted 2401
3 SASI_Rn02_00384343 predicted 2132
4 SASI_Rn02_00384344 predicted 2461
5 SASI_Rn02_00384345 predicted 4319
6 SASI_Rn02_00384346 predicted 2588
7 SASI_Rn02_00384347 predicted 4006
8 SASI_Rn02_00384348 predicted 3902
9 SASI_Rn02_00384349 predicted 3525
10 SASI_Rn02_00384350 predicted 3395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245577 predicted 4661
2 SASI_Mm01_00245578 predicted 3665
3 SASI_Mm01_00245579 predicted 4583
4 SASI_Mm01_00245580 predicted 362
5 SASI_Mm01_00245581 predicted 4607
6 SASI_Mm01_00245582 predicted 4343
7 SASI_Mm01_00245583 predicted 3905
8 SASI_Mm01_00245584 predicted 320
9 SASI_Mm01_00245585 predicted 4556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430839 predicted 4167
2 SASI_Mm02_00430840 predicted 4370
3 SASI_Mm02_00430841 predicted 3168
4 SASI_Mm02_00430842 predicted 4099
5 SASI_Mm02_00430843 predicted 340
6 SASI_Mm02_00430844 predicted 4087
7 SASI_Mm02_00430845 predicted 4120
8 SASI_Mm02_00430846 predicted 3858
9 SASI_Mm02_00430847 predicted 3419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163098
TCHH MISSION shRNA Bacterial Glycerol Stock
trichohyalin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4781s21c1
Sequence:CCGGGGTCTCAATACCGCCCTTAAACTCGAGTTTAAGGGCGGTATTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-2300s21c1
Sequence:CCGGACCTCCAAGAACGCGAGAAAGCTCGAGCTTTCTCGCGTTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4530s21c1
Sequence:CCGGGGAGAAGCGAGATGGTCAATACTCGAGTATTGACCATCTCGCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4111s21c1
Sequence:CCGGGAGCGTGAGGAGGAACAATTTCTCGAGAAATTGTTCCTCCTCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163098.1-5208s21c1
Sequence:CCGGTATGAGTTCAAGTTGACATTTCTCGAGAAATGTCAACTTGAACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163098
TCHH MISSION shRNA shRNA Plasmid DNA
trichohyalin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4781s21c1
Sequence:CCGGGGTCTCAATACCGCCCTTAAACTCGAGTTTAAGGGCGGTATTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-2300s21c1
Sequence:CCGGACCTCCAAGAACGCGAGAAAGCTCGAGCTTTCTCGCGTTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4530s21c1
Sequence:CCGGGGAGAAGCGAGATGGTCAATACTCGAGTATTGACCATCTCGCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4111s21c1
Sequence:CCGGGAGCGTGAGGAGGAACAATTTCTCGAGAAATTGTTCCTCCTCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163098.1-5208s21c1
Sequence:CCGGTATGAGTTCAAGTTGACATTTCTCGAGAAATGTCAACTTGAACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163098
TCHH MISSION shRNA Lentiviral Transduction Particles
trichohyalin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4781s21c1
Sequence:CCGGGGTCTCAATACCGCCCTTAAACTCGAGTTTAAGGGCGGTATTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-2300s21c1
Sequence:CCGGACCTCCAAGAACGCGAGAAAGCTCGAGCTTTCTCGCGTTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4530s21c1
Sequence:CCGGGGAGAAGCGAGATGGTCAATACTCGAGTATTGACCATCTCGCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163098.1-4111s21c1
Sequence:CCGGGAGCGTGAGGAGGAACAATTTCTCGAGAAATTGTTCCTCCTCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163098.1-5208s21c1
Sequence:CCGGTATGAGTTCAAGTTGACATTTCTCGAGAAATGTCAACTTGAACTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007113
TCHH MISSION shRNA Bacterial Glycerol Stock
trichohyalin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-193s21c1
Sequence:CCGGAGTAATGGGCGTGTCGATTTCCTCGAGGAAATCGACACGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007113.2-6694s21c1
Sequence:CCGGTCTTACTCTAGGGCCAATAAGCTCGAGCTTATTGGCCCTAGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-242s21c1
Sequence:CCGGTGGCTCAAGCTTGTTACTATGCTCGAGCATAGTAACAAGCTTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-3653s21c1
Sequence:CCGGATCAGCGCAGTGATCTGAAATCTCGAGATTTCAGATCACTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-5812s21c1
Sequence:CCGGAGATCTCAATACCGCCCTTAACTCGAGTTAAGGGCGGTATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007113
TCHH MISSION shRNA shRNA Plasmid DNA
trichohyalin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-193s21c1
Sequence:CCGGAGTAATGGGCGTGTCGATTTCCTCGAGGAAATCGACACGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007113.2-6694s21c1
Sequence:CCGGTCTTACTCTAGGGCCAATAAGCTCGAGCTTATTGGCCCTAGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-242s21c1
Sequence:CCGGTGGCTCAAGCTTGTTACTATGCTCGAGCATAGTAACAAGCTTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-3653s21c1
Sequence:CCGGATCAGCGCAGTGATCTGAAATCTCGAGATTTCAGATCACTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-5812s21c1
Sequence:CCGGAGATCTCAATACCGCCCTTAACTCGAGTTAAGGGCGGTATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007113
TCHH MISSION shRNA Lentiviral Transduction Particles
trichohyalin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-193s21c1
Sequence:CCGGAGTAATGGGCGTGTCGATTTCCTCGAGGAAATCGACACGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007113.2-6694s21c1
Sequence:CCGGTCTTACTCTAGGGCCAATAAGCTCGAGCTTATTGGCCCTAGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-242s21c1
Sequence:CCGGTGGCTCAAGCTTGTTACTATGCTCGAGCATAGTAACAAGCTTGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-3653s21c1
Sequence:CCGGATCAGCGCAGTGATCTGAAATCTCGAGATTTCAGATCACTGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007113.2-5812s21c1
Sequence:CCGGAGATCTCAATACCGCCCTTAACTCGAGTTAAGGGCGGTATTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks