EMAIL THIS PAGE TO A FRIEND

TCHHL1

trichohyalin-like 1

Synonyms: S100A17 THHL1
UniProtKB ID: Q5QJ38, B2RPK8, Q5VTJ9
Gene ID:
Mouse(71325) trichohyalin-like 1
Rat(295193) trichohyalin-like 1
domestic guinea pig(100727171) trichohyalin-like 1
cow(518825) trichohyalin-like 1
sheep(101120712) trichohyalin-like 1
dog(100685284) trichohyalin-like 1
domestic cat(101085306) trichohyalin-like 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021971 MISSION® esiRNA esiRNA human TCHHL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008536 Rosetta Predictions human pricing
XM_227375 Rosetta Predictions rat pricing
XR_007366 Rosetta Predictions rat pricing
NM_027762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229928 predicted 252
2 SASI_Hs01_00229929 predicted 2488
3 SASI_Hs01_00229930 predicted 2207
4 SASI_Hs01_00229931 predicted 376
5 SASI_Hs02_00305492 predicted 2484
6 SASI_Hs01_00229932 predicted 1184
7 SASI_Hs01_00229934 predicted 2443
8 SASI_Hs02_00305493 predicted 2617
9 SASI_Hs01_00229935 predicted 1329
10 SASI_Hs01_00229936 predicted 1610
11 SASI_Hs01_00229933 predicted 2769
12 SASI_Hs01_00229937 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183968 predicted 230
2 SASI_Rn01_00183969 predicted 886
3 SASI_Rn01_00183970 predicted 1252
4 SASI_Rn01_00183971 predicted 269
5 SASI_Rn01_00183972 predicted 288
6 SASI_Rn01_00183973 predicted 234
7 SASI_Rn01_00183974 predicted 950
8 SASI_Rn01_00183975 predicted 716
9 SASI_Rn01_00183976 predicted 1223
10 SASI_Rn01_00183977 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172810 predicted 224
2 SASI_Rn01_00172811 predicted 880
3 SASI_Rn01_00172812 predicted 1242
4 SASI_Rn01_00172813 predicted 263
5 SASI_Rn01_00172814 predicted 280
6 SASI_Rn01_00172815 predicted 230
7 SASI_Rn01_00172817 predicted 715
8 SASI_Rn01_00172819 predicted 703
9 SASI_Rn02_00414392 predicted 1411
10 SASI_Rn02_00414393 predicted 1279
11 SASI_Rn01_00172816 predicted 943
12 SASI_Rn01_00172818 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057571 predicted 769
2 SASI_Mm01_00057572 predicted 1312
3 SASI_Mm01_00057573 predicted 650
4 SASI_Mm01_00057574 predicted 1467
5 SASI_Mm01_00057575 predicted 335
6 SASI_Mm01_00057576 predicted 300
7 SASI_Mm01_00057577 predicted 349
8 SASI_Mm01_00057578 predicted 1784
9 SASI_Mm01_00057579 predicted 499
10 SASI_Mm01_00057580 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027762
TCHHL1 MISSION shRNA Bacterial Glycerol Stock
trichohyalin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1558s21c1
Sequence:CCGGAGATTCTGAGTTATCACTTACCTCGAGGTAAGTGATAACTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-664s21c1
Sequence:CCGGATATGATGGAGTCCAATTTAACTCGAGTTAAATTGGACTCCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-315s1c1
Sequence:CCGGGCTTATTGAATCCCTCTTATTCTCGAGAATAAGAGGGATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-947s1c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-452s21c1
Sequence:CCGGACTCAAGAAAGGCTCATATTTCTCGAGAAATATGAGCCTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-947s21c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1180s21c1
Sequence:CCGGACATGAAAGAATAACTCTATCCTCGAGGATAGAGTTATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.1-1680s1c1
Sequence:CCGGCAGAGTCAGATAGACCACCATCTCGAGATGGTGGTCTATCTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027762
TCHHL1 MISSION shRNA shRNA Plasmid DNA
trichohyalin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1558s21c1
Sequence:CCGGAGATTCTGAGTTATCACTTACCTCGAGGTAAGTGATAACTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-664s21c1
Sequence:CCGGATATGATGGAGTCCAATTTAACTCGAGTTAAATTGGACTCCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-315s1c1
Sequence:CCGGGCTTATTGAATCCCTCTTATTCTCGAGAATAAGAGGGATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-947s1c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-452s21c1
Sequence:CCGGACTCAAGAAAGGCTCATATTTCTCGAGAAATATGAGCCTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-947s21c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1180s21c1
Sequence:CCGGACATGAAAGAATAACTCTATCCTCGAGGATAGAGTTATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.1-1680s1c1
Sequence:CCGGCAGAGTCAGATAGACCACCATCTCGAGATGGTGGTCTATCTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027762
TCHHL1 MISSION shRNA Lentiviral Transduction Particles
trichohyalin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1558s21c1
Sequence:CCGGAGATTCTGAGTTATCACTTACCTCGAGGTAAGTGATAACTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-664s21c1
Sequence:CCGGATATGATGGAGTCCAATTTAACTCGAGTTAAATTGGACTCCATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-315s1c1
Sequence:CCGGGCTTATTGAATCCCTCTTATTCTCGAGAATAAGAGGGATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.3-947s1c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-452s21c1
Sequence:CCGGACTCAAGAAAGGCTCATATTTCTCGAGAAATATGAGCCTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-947s21c1
Sequence:CCGGGAGCCTATGGATGATACTAAACTCGAGTTTAGTATCATCCATAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027762.3-1180s21c1
Sequence:CCGGACATGAAAGAATAACTCTATCCTCGAGGATAGAGTTATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027762.1-1680s1c1
Sequence:CCGGCAGAGTCAGATAGACCACCATCTCGAGATGGTGGTCTATCTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008536
TCHHL1 MISSION shRNA Bacterial Glycerol Stock
trichohyalin-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2621s1c1
Sequence:CCGGCAGCCAAGCATCACAACCATACTCGAGTATGGTTGTGATGCTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008536.1-1467s1c1
Sequence:CCGGGAGGCAGAACACACCAAAGAACTCGAGTTCTTTGGTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-3342s1c1
Sequence:CCGGGCTGAATCTATCGCCATGGATCTCGAGATCCATGGCGATAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-597s1c1
Sequence:CCGGCCTAAGAACAAACACCTGGAACTCGAGTTCCAGGTGTTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-2839s1c1
Sequence:CCGGGTACACATTCAGATGCAGATTCTCGAGAATCTGCATCTGAATGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2623s1c1
Sequence:CCGGGCCAAGCATCACAACCATATACTCGAGTATATGGTTGTGATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008536
TCHHL1 MISSION shRNA shRNA Plasmid DNA
trichohyalin-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2621s1c1
Sequence:CCGGCAGCCAAGCATCACAACCATACTCGAGTATGGTTGTGATGCTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008536.1-1467s1c1
Sequence:CCGGGAGGCAGAACACACCAAAGAACTCGAGTTCTTTGGTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-3342s1c1
Sequence:CCGGGCTGAATCTATCGCCATGGATCTCGAGATCCATGGCGATAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-597s1c1
Sequence:CCGGCCTAAGAACAAACACCTGGAACTCGAGTTCCAGGTGTTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-2839s1c1
Sequence:CCGGGTACACATTCAGATGCAGATTCTCGAGAATCTGCATCTGAATGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2623s1c1
Sequence:CCGGGCCAAGCATCACAACCATATACTCGAGTATATGGTTGTGATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008536
TCHHL1 MISSION shRNA Lentiviral Transduction Particles
trichohyalin-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2621s1c1
Sequence:CCGGCAGCCAAGCATCACAACCATACTCGAGTATGGTTGTGATGCTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008536.1-1467s1c1
Sequence:CCGGGAGGCAGAACACACCAAAGAACTCGAGTTCTTTGGTGTGTTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-3342s1c1
Sequence:CCGGGCTGAATCTATCGCCATGGATCTCGAGATCCATGGCGATAGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-597s1c1
Sequence:CCGGCCTAAGAACAAACACCTGGAACTCGAGTTCCAGGTGTTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008536.1-2839s1c1
Sequence:CCGGGTACACATTCAGATGCAGATTCTCGAGAATCTGCATCTGAATGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008536.1-2623s1c1
Sequence:CCGGGCCAAGCATCACAACCATATACTCGAGTATATGGTTGTGATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks