EMAIL THIS PAGE TO A FRIEND

TCHP

trichoplein, keratin filament binding

Synonyms: TpMs
UniProtKB ID: Q9BT92, Q8NAG0
Gene ID:
Mouse(77832) trichoplein, keratin filament binding
Rat(304547) trichoplein, keratin filament binding
cow(522380) trichoplein, keratin filament binding
sheep(101122891) trichoplein, keratin filament binding
domestic guinea pig(100726790) trichoplein, keratin filament binding
naked mole-rat(101705491) trichoplein, keratin filament binding
Zebrafish(678595) trichoplein, keratin filament binding
chicken(425209) trichoplein, keratin filament binding
dog(477521) trichoplein, keratin filament binding
Horse(100059689) trichoplein, keratin filament binding
domestic cat(101084393) trichoplein, keratin filament binding
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032300 Rosetta Predictions human pricing
XM_222232 Rosetta Predictions rat pricing
XR_009369 Rosetta Predictions rat pricing
NM_029992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242398 predicted 2076
2 SASI_Hs01_00242399 predicted 2083
3 SASI_Hs01_00242400 predicted 321
4 SASI_Hs01_00242402 predicted 1963
5 SASI_Hs01_00242403 predicted 2122
6 SASI_Hs01_00242404 predicted 1923
7 SASI_Hs01_00242405 predicted 1984
8 SASI_Hs02_00359637 predicted 1953
9 SASI_Hs02_00359638 predicted 2169
10 SASI_Hs01_00242406 predicted 1862
11 SASI_Hs01_00242401 predicted 1960
12 SASI_Hs01_00242407 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380665 predicted 1773
2 SASI_Rn02_00380666 predicted 1540
3 SASI_Rn02_00380667 predicted 426
4 SASI_Rn02_00380668 predicted 2154
5 SASI_Rn02_00380669 predicted 2035
6 SASI_Rn02_00380670 predicted 2136
7 SASI_Rn02_00380671 predicted 1517
8 SASI_Rn02_00380672 predicted 1957
9 SASI_Rn02_00380673 predicted 1804
10 SASI_Rn02_00380674 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164928 predicted 1734
2 SASI_Rn01_00164929 predicted 623
3 SASI_Rn01_00164930 predicted 1497
4 SASI_Rn01_00164931 predicted 385
5 SASI_Rn01_00164932 predicted 327
6 SASI_Rn02_00419516 predicted 1975
7 SASI_Rn01_00164933 predicted 2114
8 SASI_Rn01_00164934 predicted 1777
9 SASI_Rn01_00164935 predicted 1476
10 SASI_Rn01_00164936 predicted 1475
11 SASI_Rn01_00164937 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336341 predicted 1955
2 SASI_Mm02_00336342 predicted 1778
3 SASI_Mm02_00336343 predicted 1892
4 SASI_Mm01_00096133 predicted 331
5 SASI_Mm02_00336344 predicted 1945
6 SASI_Mm02_00336345 predicted 271
7 SASI_Mm02_00336346 predicted 2079
8 SASI_Mm02_00336347 predicted 2091
9 SASI_Mm02_00336348 predicted 1763
10 SASI_Mm02_00336349 predicted 2094
11 SASI_Mm01_00096130 predicted 1341
12 SASI_Mm01_00096131 predicted 1367
13 SASI_Mm01_00096132 predicted 1012
14 SASI_Mm01_00096134 predicted 1147
15 SASI_Mm01_00096135 predicted 1011
16 SASI_Mm01_00096136 predicted 231
17 SASI_Mm01_00096137 predicted 1538
18 SASI_Mm01_00096138 predicted 213
19 SASI_Mm01_00096139 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032300
VALIDATED
TCHP MISSION shRNA Bacterial Glycerol Stock
trichoplein, keratin filament binding
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1443s1c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032300.2-2718s1c1
Sequence:CCGGCCAGAAATCTCTCCCACCATTCTCGAGAATGGTGGGAGAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032300.2-756s1c1
Sequence:CCGGGAGCAAGAGAACAAACGGTATCTCGAGATACCGTTTGTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032300.2-603s1c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1028s1c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-759s1c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-538s1c1
Sequence:CCGGGCATGAACTTGCAGGAAAGAACTCGAGTTCTTTCCTGCAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1442s21c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1027s21c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-758s21c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-602s21c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032300
VALIDATED
TCHP MISSION shRNA shRNA Plasmid DNA
trichoplein, keratin filament binding
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1443s1c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032300.2-2718s1c1
Sequence:CCGGCCAGAAATCTCTCCCACCATTCTCGAGAATGGTGGGAGAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032300.2-756s1c1
Sequence:CCGGGAGCAAGAGAACAAACGGTATCTCGAGATACCGTTTGTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032300.2-603s1c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1028s1c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-759s1c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-538s1c1
Sequence:CCGGGCATGAACTTGCAGGAAAGAACTCGAGTTCTTTCCTGCAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1442s21c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1027s21c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-758s21c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-602s21c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032300
VALIDATED
TCHP MISSION shRNA Lentiviral Transduction Particles
trichoplein, keratin filament binding
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1443s1c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032300.2-2718s1c1
Sequence:CCGGCCAGAAATCTCTCCCACCATTCTCGAGAATGGTGGGAGAGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032300.2-756s1c1
Sequence:CCGGGAGCAAGAGAACAAACGGTATCTCGAGATACCGTTTGTTCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032300.2-603s1c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-1028s1c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-759s1c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032300.2-538s1c1
Sequence:CCGGGCATGAACTTGCAGGAAAGAACTCGAGTTCTTTCCTGCAAGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1442s21c1
Sequence:CCGGCGAAATCTTGAGGAGGTGAGACTCGAGTCTCACCTCCTCAAGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-1027s21c1
Sequence:CCGGGCGTTTCTTGAGACATCAGTACTCGAGTACTGATGTCTCAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-758s21c1
Sequence:CCGGCAAGAGAACAAACGGTATGAACTCGAGTTCATACCGTTTGTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032300.4-602s21c1
Sequence:CCGGCAGAGGAAACTGATTGCTGAACTCGAGTTCAGCAATCAGTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029992
TCHP MISSION shRNA Bacterial Glycerol Stock
trichoplein, keratin filament binding
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029992.1-281s1c1
Sequence:CCGGCCTACCATTGTGAGAAGATGACTCGAGTCATCTTCTCACAATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2968s1c1
Sequence:CCGGGCTGTATCACTTCCCTTCCATCTCGAGATGGAAGGGAAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2143s1c1
Sequence:CCGGCCAGAGATCAGGAATGCTTTACTCGAGTAAAGCATTCCTGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-649s21c1
Sequence:CCGGTTCACAAGAAGCACGTGATAACTCGAGTTATCACGTGCTTCTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-282s21c1
Sequence:CCGGGAACAGAACAGTCGCTATTTCCTCGAGGAAATAGCGACTGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-217s21c1
Sequence:CCGGGCCGGAAACACATGGATCTTCCTCGAGGAAGATCCATGTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029992.2-2554s21c1
Sequence:CCGGTGGCGACAGTCGGGTTGTTATCTCGAGATAACAACCCGACTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-1381s21c1
Sequence:CCGGCCCTCAAACACAGGGAGAAACCTCGAGGTTTCTCCCTGTGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029992
TCHP MISSION shRNA shRNA Plasmid DNA
trichoplein, keratin filament binding
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029992.1-281s1c1
Sequence:CCGGCCTACCATTGTGAGAAGATGACTCGAGTCATCTTCTCACAATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2968s1c1
Sequence:CCGGGCTGTATCACTTCCCTTCCATCTCGAGATGGAAGGGAAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2143s1c1
Sequence:CCGGCCAGAGATCAGGAATGCTTTACTCGAGTAAAGCATTCCTGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-649s21c1
Sequence:CCGGTTCACAAGAAGCACGTGATAACTCGAGTTATCACGTGCTTCTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-282s21c1
Sequence:CCGGGAACAGAACAGTCGCTATTTCCTCGAGGAAATAGCGACTGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-217s21c1
Sequence:CCGGGCCGGAAACACATGGATCTTCCTCGAGGAAGATCCATGTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029992.2-2554s21c1
Sequence:CCGGTGGCGACAGTCGGGTTGTTATCTCGAGATAACAACCCGACTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-1381s21c1
Sequence:CCGGCCCTCAAACACAGGGAGAAACCTCGAGGTTTCTCCCTGTGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029992
TCHP MISSION shRNA Lentiviral Transduction Particles
trichoplein, keratin filament binding
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029992.1-281s1c1
Sequence:CCGGCCTACCATTGTGAGAAGATGACTCGAGTCATCTTCTCACAATGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2968s1c1
Sequence:CCGGGCTGTATCACTTCCCTTCCATCTCGAGATGGAAGGGAAGTGATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029992.1-2143s1c1
Sequence:CCGGCCAGAGATCAGGAATGCTTTACTCGAGTAAAGCATTCCTGATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-649s21c1
Sequence:CCGGTTCACAAGAAGCACGTGATAACTCGAGTTATCACGTGCTTCTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-282s21c1
Sequence:CCGGGAACAGAACAGTCGCTATTTCCTCGAGGAAATAGCGACTGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-217s21c1
Sequence:CCGGGCCGGAAACACATGGATCTTCCTCGAGGAAGATCCATGTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029992.2-2554s21c1
Sequence:CCGGTGGCGACAGTCGGGTTGTTATCTCGAGATAACAACCCGACTGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029992.2-1381s21c1
Sequence:CCGGCCCTCAAACACAGGGAGAAACCTCGAGGTTTCTCCCTGTGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks