EMAIL THIS PAGE TO A FRIEND

TCIRG1

T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3

Synonyms: ATP6N1C ATP6V0A3 Atp6i OC-116kDa OC116 OPTB1 Stv1 TIRC7 Vph1 a3
UniProtKB ID: Q13488, O75877, Q8WVC5
Gene ID:
Human(10312) Summary: Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
Mouse(27060) T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Rat(293650) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Zebrafish(100003139) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
chicken(395472) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
domestic cat(101083709) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
dog(483691) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
naked mole-rat(101720677) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Domestic Rabbit(100008819) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
domestic guinea pig(100712820) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
cow(513684) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
sheep(101113184) T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006019 Rosetta Predictions human pricing
NM_006053 Rosetta Predictions human pricing
NM_199089 Rosetta Predictions rat pricing
XM_574593 Rosetta Predictions rat pricing
NM_016921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190457 predicted 1134
2 SASI_Hs01_00190458 predicted 1445
3 SASI_Hs01_00190460 predicted 1393
4 SASI_Hs01_00190461 predicted 1470
5 SASI_Hs01_00190462 predicted 1387
6 SASI_Hs01_00190463 predicted 1848
7 SASI_Hs01_00190464 predicted 1849
8 SASI_Hs01_00190465 predicted 1435
9 SASI_Hs01_00190466 predicted 1396
10 SASI_Hs02_00340736 predicted 1671
11 SASI_Hs01_00190459 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019702 predicted 914
2 SASI_Hs01_00019703 predicted 1220
3 SASI_Hs01_00019705 predicted 1181
4 SASI_Hs01_00019706 predicted 1257
5 SASI_Hs01_00019707 predicted 1169
6 SASI_Hs01_00019708 predicted 1630
7 SASI_Hs01_00019709 predicted 1634
8 SASI_Hs01_00019710 predicted 1216
9 SASI_Hs01_00019711 predicted 1179
10 SASI_Hs02_00340807 predicted 1449
11 SASI_Hs01_00019704 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098028 predicted 2118
2 SASI_Rn02_00270096 predicted 2124
3 SASI_Rn01_00098030 predicted 1527
4 SASI_Rn01_00098031 predicted 1278
5 SASI_Rn01_00098032 predicted 1814
6 SASI_Rn01_00098033 predicted 638
7 SASI_Rn01_00098034 predicted 1948
8 SASI_Rn01_00098035 predicted 1262
9 SASI_Rn02_00270097 predicted 1820
10 SASI_Rn01_00098036 predicted 322
11 SASI_Rn01_00098029 predicted 928
12 SASI_Rn01_00098037 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160300 predicted 595
2 SASI_Rn01_00160301 predicted 788
3 SASI_Rn01_00160302 predicted 676
4 SASI_Rn01_00160303 predicted 659
5 SASI_Rn01_00160304 predicted 644
6 SASI_Rn01_00160305 predicted 731
7 SASI_Rn01_00160306 predicted 751
8 SASI_Rn01_00160307 predicted 734
9 SASI_Rn01_00160308 predicted 622
10 SASI_Rn01_00160309 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160942 predicted 641
2 SASI_Mm01_00160943 predicted 2319
3 SASI_Mm01_00160944 predicted 843
4 SASI_Mm01_00160945 predicted 2287
5 SASI_Mm01_00160946 predicted 341
6 SASI_Mm01_00160947 predicted 1057
7 SASI_Mm01_00160948 predicted 2281
8 SASI_Mm01_00160949 predicted 1976
9 SASI_Mm01_00160950 predicted 1907
10 SASI_Mm01_00160951 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016921
VALIDATED
TCIRG1 MISSION shRNA Bacterial Glycerol Stock
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1908s21c1
Sequence:CCGGGCTACCTTGTGTTCCTCATTGCTCGAGCAATGAGGAACACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1981s21c1
Sequence:CCGGCCTCATTCACTTCATCAATATCTCGAGATATTGATGAAGTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-648s21c1
Sequence:CCGGATTCAGACCTGAAGGTCAATTCTCGAGAATTGACCTTCAGGTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1557s21c1
Sequence:CCGGTCAGCCGAGCCACCACTATTTCTCGAGAAATAGTGGTGGCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1530s21c1
Sequence:CCGGACACTGGCTTCATCTACAATGCTCGAGCATTGTAGATGAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-336s21c1
Sequence:CCGGAGGAACTGGAGAAGACGTTTACTCGAGTAAACGTCTTCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1390s21c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-800s1c1
Sequence:CCGGCCTGCAACTTGGATGACCTTTCTCGAGAAAGGTCATCCAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016921.2-1390s1c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016921.2-266s1c1
Sequence:CCGGGAGTTCAGAGACCTCAACGAACTCGAGTTCGTTGAGGTCTCTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1666s1c1
Sequence:CCGGCCCTAACATCACTGGTGTCTTCTCGAGAAGACACCAGTGATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1078s1c1
Sequence:CCGGCCTCAACCAGTGCAGTGTGAACTCGAGTTCACACTGCACTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016921
VALIDATED
TCIRG1 MISSION shRNA shRNA Plasmid DNA
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1908s21c1
Sequence:CCGGGCTACCTTGTGTTCCTCATTGCTCGAGCAATGAGGAACACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1981s21c1
Sequence:CCGGCCTCATTCACTTCATCAATATCTCGAGATATTGATGAAGTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-648s21c1
Sequence:CCGGATTCAGACCTGAAGGTCAATTCTCGAGAATTGACCTTCAGGTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1557s21c1
Sequence:CCGGTCAGCCGAGCCACCACTATTTCTCGAGAAATAGTGGTGGCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1530s21c1
Sequence:CCGGACACTGGCTTCATCTACAATGCTCGAGCATTGTAGATGAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-336s21c1
Sequence:CCGGAGGAACTGGAGAAGACGTTTACTCGAGTAAACGTCTTCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1390s21c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-800s1c1
Sequence:CCGGCCTGCAACTTGGATGACCTTTCTCGAGAAAGGTCATCCAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016921.2-1390s1c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016921.2-266s1c1
Sequence:CCGGGAGTTCAGAGACCTCAACGAACTCGAGTTCGTTGAGGTCTCTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1666s1c1
Sequence:CCGGCCCTAACATCACTGGTGTCTTCTCGAGAAGACACCAGTGATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1078s1c1
Sequence:CCGGCCTCAACCAGTGCAGTGTGAACTCGAGTTCACACTGCACTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016921
VALIDATED
TCIRG1 MISSION shRNA Lentiviral Transduction Particles
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1908s21c1
Sequence:CCGGGCTACCTTGTGTTCCTCATTGCTCGAGCAATGAGGAACACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1981s21c1
Sequence:CCGGCCTCATTCACTTCATCAATATCTCGAGATATTGATGAAGTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-648s21c1
Sequence:CCGGATTCAGACCTGAAGGTCAATTCTCGAGAATTGACCTTCAGGTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1557s21c1
Sequence:CCGGTCAGCCGAGCCACCACTATTTCTCGAGAAATAGTGGTGGCTCGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016921.2-1530s21c1
Sequence:CCGGACACTGGCTTCATCTACAATGCTCGAGCATTGTAGATGAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-336s21c1
Sequence:CCGGAGGAACTGGAGAAGACGTTTACTCGAGTAAACGTCTTCTCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016921.2-1390s21c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-800s1c1
Sequence:CCGGCCTGCAACTTGGATGACCTTTCTCGAGAAAGGTCATCCAAGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016921.2-1390s1c1
Sequence:CCGGCGGACTGCTCATGTTTCTCTTCTCGAGAAGAGAAACATGAGCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016921.2-266s1c1
Sequence:CCGGGAGTTCAGAGACCTCAACGAACTCGAGTTCGTTGAGGTCTCTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1666s1c1
Sequence:CCGGCCCTAACATCACTGGTGTCTTCTCGAGAAGACACCAGTGATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016921.2-1078s1c1
Sequence:CCGGCCTCAACCAGTGCAGTGTGAACTCGAGTTCACACTGCACTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006019
VALIDATED
TCIRG1 MISSION shRNA Bacterial Glycerol Stock
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-804s21c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-253s21c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1698s21c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1857s21c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-996s21c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-253s1c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-804s1c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-996s1c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1698s1c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1857s1c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006019
VALIDATED
TCIRG1 MISSION shRNA shRNA Plasmid DNA
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-804s21c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-253s21c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1698s21c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1857s21c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-996s21c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-253s1c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-804s1c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-996s1c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1698s1c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1857s1c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006019
VALIDATED
TCIRG1 MISSION shRNA Lentiviral Transduction Particles
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-804s21c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-253s21c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1698s21c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-1857s21c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006019.2-996s21c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-253s1c1
Sequence:CCGGAGACGCTTTGTGGTTGATGTTCTCGAGAACATCAACCACAAAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-804s1c1
Sequence:CCGGCCGCAAGATCACGGACTGCTTCTCGAGAAGCAGTCCGTGATCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006019.2-996s1c1
Sequence:CCGGCCACAAGATGAAGGCCGTGTACTCGAGTACACGGCCTTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1698s1c1
Sequence:CCGGCAACTCCTTCAAGATGAAGATCTCGAGATCTTCATCTTGAAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006019.2-1857s1c1
Sequence:CCGGCCTCGTGTTCCTAGTCATCTACTCGAGTAGATGACTAGGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks