EMAIL THIS PAGE TO A FRIEND

TCL1A

T-cell leukemia/lymphoma 1A

Synonyms: TCL1
UniProtKB ID: P56279, Q6IBK7
Gene ID:
Human(8115) Summary: Overexpression of the TCL1 gene in humans has been implicated in the development of mature T cell leukemia, in which chromosomal rearrangements bring the TCL1 gene in close proximity to the T-cell antigen receptor (TCR)-alpha (MIM 186880) or TCR-beta (MIM 186930) regulatory elements (summarized by Virgilio et al., 1998 [PubMed 9520462]
Rat(690575) T-cell leukemia/lymphoma 1A
cow(506540) T-cell leukemia/lymphoma 1A
sheep(101116094) T-cell leukemia/lymphoma 1A
naked mole-rat(101704738) T-cell leukemia/lymphoma 1A
dog(612421) uncharacterized LOC612421
domestic cat(101090193) T-cell leukemia/lymphoma 1A
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22194F Anti-TCL1A antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501025 Anti-TCL1A antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1406645 Anti-TCL1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1411981 ANTI-TCL1A antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411982 ANTI-TCL1A antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412201 ANTI-TCL1A antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412206 ANTI-TCL1A antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412230 ANTI-TCL1A antibody produced in mouse clone 1E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412383 ANTI-TCL1A antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412384 ANTI-TCL1A antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA016604 Anti-TCL1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5500183 Anti-TCL1A antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP248, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB2104341 Anti-TCL1A, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0008115M6 Monoclonal Anti-TCL1A antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404572 Monoclonal Anti-TCL1A, (C-terminal) antibody produced in mouse clone 3G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021966 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055641 MISSION® esiRNA esiRNA human TCL1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098725 Rosetta Predictions human pricing
NM_021966 Rosetta Predictions human pricing
NM_001109601 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319759 predicted 825
2 SASI_Hs02_00319760 predicted 234
3 SASI_Hs02_00319761 predicted 908
4 SASI_Hs02_00319762 predicted 903
5 SASI_Hs02_00319763 predicted 234
6 SASI_Hs02_00319764 predicted 726
7 SASI_Hs02_00319765 predicted 907
8 SASI_Hs02_00319766 predicted 855
9 SASI_Hs02_00319767 predicted 933
10 SASI_Hs02_00319768 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022612 predicted 828
2 SASI_Hs02_00355310 predicted 232
3 SASI_Hs01_00022614 predicted 917
4 SASI_Hs01_00022615 predicted 911
5 SASI_Hs02_00355311 predicted 229
6 SASI_Hs01_00022616 predicted 732
7 SASI_Hs01_00022617 predicted 913
8 SASI_Hs01_00022619 predicted 866
9 SASI_Hs01_00022620 predicted 939
10 SASI_Hs01_00022621 predicted 966
11 SASI_Hs01_00022613 predicted 765
12 SASI_Hs01_00022618 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249977 predicted 250
2 SASI_Rn02_00249978 predicted 320
3 SASI_Rn02_00249979 predicted 252
4 SASI_Rn02_00249980 predicted 373
5 SASI_Rn02_00249981 predicted 450
6 SASI_Rn02_00249982 predicted 164
7 SASI_Rn02_00249983 predicted 130
8 SASI_Rn02_00249984 predicted 245
9 SASI_Rn02_00249985 predicted 773
10 SASI_Rn02_00249986 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021966
TCL1A MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia/lymphoma 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-150s1c1
Sequence:CCGGGCCCTTAACCATCGAGATAAACTCGAGTTTATCTCGATGGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021966.1-846s1c1
Sequence:CCGGGCATGTAAACACGCCTGCAAACTCGAGTTTGCAGGCGTGTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-321s1c1
Sequence:CCGGGCGCTTAGTGTACCACATCAACTCGAGTTGATGTGGTACACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-105s1c1
Sequence:CCGGCTGGGAGAAGTTCGTGTATTTCTCGAGAAATACACGAACTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-149s1c1
Sequence:CCGGTGCCCTTAACCATCGAGATAACTCGAGTTATCTCGATGGTTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021966
TCL1A MISSION shRNA shRNA Plasmid DNA
T-cell leukemia/lymphoma 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-150s1c1
Sequence:CCGGGCCCTTAACCATCGAGATAAACTCGAGTTTATCTCGATGGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021966.1-846s1c1
Sequence:CCGGGCATGTAAACACGCCTGCAAACTCGAGTTTGCAGGCGTGTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-321s1c1
Sequence:CCGGGCGCTTAGTGTACCACATCAACTCGAGTTGATGTGGTACACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-105s1c1
Sequence:CCGGCTGGGAGAAGTTCGTGTATTTCTCGAGAAATACACGAACTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-149s1c1
Sequence:CCGGTGCCCTTAACCATCGAGATAACTCGAGTTATCTCGATGGTTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021966
TCL1A MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia/lymphoma 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-150s1c1
Sequence:CCGGGCCCTTAACCATCGAGATAAACTCGAGTTTATCTCGATGGTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021966.1-846s1c1
Sequence:CCGGGCATGTAAACACGCCTGCAAACTCGAGTTTGCAGGCGTGTTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-321s1c1
Sequence:CCGGGCGCTTAGTGTACCACATCAACTCGAGTTGATGTGGTACACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-105s1c1
Sequence:CCGGCTGGGAGAAGTTCGTGTATTTCTCGAGAAATACACGAACTTCTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021966.1-149s1c1
Sequence:CCGGTGCCCTTAACCATCGAGATAACTCGAGTTATCTCGATGGTTAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks