EMAIL THIS PAGE TO A FRIEND

TCL1B

T-cell leukemia/lymphoma 1B

Synonyms: SYN-1 TML1
UniProtKB ID: O95988, A6NEK7, Q6IAR7, Q9UBQ4
Gene ID:
dog(612418) T-cell leukemia/lymphoma 1B
domestic cat(101089946) T-cell leukemia/lymphoma 1B
cow(100848382) T-cell leukemia/lymphoma 1B
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004918 Rosetta Predictions human pricing
NM_199206 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111039 predicted 853
2 SASI_Hs01_00111040 predicted 892
3 SASI_Hs01_00111041 predicted 857
4 SASI_Hs01_00111042 predicted 701
5 SASI_Hs01_00111043 predicted 858
6 SASI_Hs01_00111044 predicted 863
7 SASI_Hs01_00111045 predicted 819
8 SASI_Hs01_00111046 predicted 873
9 SASI_Hs01_00111047 predicted 826
10 SASI_Hs01_00111048 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372663 predicted 42
2 SASI_Hs02_00372664 predicted 355
3 SASI_Hs02_00372665 predicted 462
4 SASI_Hs02_00372666 predicted 334
5 SASI_Hs02_00372667 predicted 224
6 SASI_Hs02_00372668 predicted 45
7 SASI_Hs02_00372669 predicted 369
8 SASI_Hs02_00372670 predicted 135
9 SASI_Hs02_00372671 predicted 144
10 SASI_Hs02_00372672 predicted 156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004918
TCL1B MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia/lymphoma 1B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004918.2-574s1c1
Sequence:CCGGGCACACTCAGTTTCTCTCGTTCTCGAGAACGAGAGAAACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-102s1c1
Sequence:CCGGGCCTGGCATCTACGAAGATGACTCGAGTCATCTTCGTAGATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-340s1c1
Sequence:CCGGGATTCCAGTTTCTGGGAAATACTCGAGTATTTCCCAGAAACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-372s1c1
Sequence:CCGGCCAGATTGACTCTATGGAGCACTCGAGTGCTCCATAGAGTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-200s1c1
Sequence:CCGGGCAGATATGAACCCAGCATCACTCGAGTGATGCTGGGTTCATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004918.2-142s21c1
Sequence:CCGGACTGTGGTCGTGCGGTTCAATCTCGAGATTGAACCGCACGACCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004918
TCL1B MISSION shRNA shRNA Plasmid DNA
T-cell leukemia/lymphoma 1B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004918.2-574s1c1
Sequence:CCGGGCACACTCAGTTTCTCTCGTTCTCGAGAACGAGAGAAACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-102s1c1
Sequence:CCGGGCCTGGCATCTACGAAGATGACTCGAGTCATCTTCGTAGATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-340s1c1
Sequence:CCGGGATTCCAGTTTCTGGGAAATACTCGAGTATTTCCCAGAAACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-372s1c1
Sequence:CCGGCCAGATTGACTCTATGGAGCACTCGAGTGCTCCATAGAGTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-200s1c1
Sequence:CCGGGCAGATATGAACCCAGCATCACTCGAGTGATGCTGGGTTCATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004918.2-142s21c1
Sequence:CCGGACTGTGGTCGTGCGGTTCAATCTCGAGATTGAACCGCACGACCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004918
TCL1B MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia/lymphoma 1B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004918.2-574s1c1
Sequence:CCGGGCACACTCAGTTTCTCTCGTTCTCGAGAACGAGAGAAACTGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-102s1c1
Sequence:CCGGGCCTGGCATCTACGAAGATGACTCGAGTCATCTTCGTAGATGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-340s1c1
Sequence:CCGGGATTCCAGTTTCTGGGAAATACTCGAGTATTTCCCAGAAACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-372s1c1
Sequence:CCGGCCAGATTGACTCTATGGAGCACTCGAGTGCTCCATAGAGTCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004918.2-200s1c1
Sequence:CCGGGCAGATATGAACCCAGCATCACTCGAGTGATGCTGGGTTCATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004918.2-142s21c1
Sequence:CCGGACTGTGGTCGTGCGGTTCAATCTCGAGATTGAACCGCACGACCACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks