EMAIL THIS PAGE TO A FRIEND

TCL6

T-cell leukemia/lymphoma 6 (non-protein coding)

Synonyms: TNG1 TNG2
Species: Human TCL6(27004)
Gene ID:
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012468 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116761 MISSION® esiRNA esiRNA human TCL6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012468 Rosetta Predictions human pricing
NM_014418 Rosetta Predictions human pricing
NM_020550 Rosetta Predictions human pricing
NM_020552 Rosetta Predictions human pricing
NM_020553 Rosetta Predictions human pricing
NM_020554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221128 predicted 2025
2 SASI_Hs01_00221129 predicted 2179
3 SASI_Hs01_00221130 predicted 2200
4 SASI_Hs01_00221131 predicted 2089
5 SASI_Hs01_00221132 predicted 1910
6 SASI_Hs01_00221133 predicted 1877
7 SASI_Hs01_00221134 predicted 2170
8 SASI_Hs01_00221135 predicted 1815
9 SASI_Hs01_00221136 predicted 2102
10 SASI_Hs01_00221137 predicted 2620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210030 predicted 2033
2 SASI_Hs01_00210031 predicted 2177
3 SASI_Hs01_00210032 predicted 2201
4 SASI_Hs01_00210033 predicted 2086
5 SASI_Hs01_00210034 predicted 1910
6 SASI_Hs01_00210035 predicted 1879
7 SASI_Hs01_00210036 predicted 2170
8 SASI_Hs01_00210037 predicted 1811
9 SASI_Hs01_00210038 predicted 2106
10 SASI_Hs01_00210039 predicted 2627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014493 predicted 2349
2 SASI_Hs01_00014494 predicted 2345
3 SASI_Hs02_00353594 predicted 2432
4 SASI_Hs02_00353595 predicted 2362
5 SASI_Hs01_00014497 predicted 1909
6 SASI_Hs01_00014499 predicted 1918
7 SASI_Hs01_00014500 predicted 2692
8 SASI_Hs01_00014501 predicted 2396
9 SASI_Hs01_00014502 predicted 1863
10 SASI_Hs02_00353596 predicted 1875
11 SASI_Hs01_00014495 predicted 2185
12 SASI_Hs01_00014496 predicted 2199
13 SASI_Hs01_00014498 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234508 predicted 2520
2 SASI_Hs01_00234509 predicted 2443
3 SASI_Hs02_00353597 predicted 1894
4 SASI_Hs02_00353598 predicted 1896
5 SASI_Hs01_00234511 predicted 1973
6 SASI_Hs02_00353599 predicted 1912
7 SASI_Hs01_00234512 predicted 2469
8 SASI_Hs01_00234513 predicted 2318
9 SASI_Hs01_00234514 predicted 1948
10 SASI_Hs01_00234515 predicted 2509
11 SASI_Hs01_00234510 predicted 2620
12 SASI_Hs01_00234516 predicted 2366
13 SASI_Hs01_00234517 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242850 predicted 1413
2 SASI_Hs01_00242851 predicted 2169
3 SASI_Hs01_00242852 predicted 2081
4 SASI_Hs02_00353600 predicted 1538
5 SASI_Hs02_00353601 predicted 1538
6 SASI_Hs01_00242854 predicted 1617
7 SASI_Hs02_00353602 predicted 1556
8 SASI_Hs01_00242855 predicted 2109
9 SASI_Hs01_00242856 predicted 1963
10 SASI_Hs01_00242857 predicted 1592
11 SASI_Hs01_00242853 predicted 2265
12 SASI_Hs01_00242858 predicted 2156
13 SASI_Hs01_00242859 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118179 predicted 1585
2 SASI_Hs01_00118180 predicted 1586
3 SASI_Hs02_00353603 predicted 1729
4 SASI_Hs01_00118181 predicted 1618
5 SASI_Hs02_00353604 predicted 1732
6 SASI_Hs01_00118182 predicted 2094
7 SASI_Hs01_00118183 predicted 1817
8 SASI_Hs02_00353605 predicted 1746
9 SASI_Hs01_00118185 predicted 2154
10 SASI_Hs01_00118186 predicted 1785
11 SASI_Hs01_00118178 predicted 2141
12 SASI_Hs01_00118184 predicted 2139
13 SASI_Hs01_00118187 predicted 1762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012468
TCL6 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia/lymphoma 6 (non-protein coding)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-1883s1c1
Sequence:CCGGCTGCTAAGTTTCCAGAGGTGTCTCGAGACACCTCTGGAAACTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1878s1c1
Sequence:CCGGCCTTCCTGCTAAGTTTCCAGACTCGAGTCTGGAAACTTAGCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2112s1c1
Sequence:CCGGGAAGACACAGCAAGTGAGAAACTCGAGTTTCTCACTTGCTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1821s1c1
Sequence:CCGGGATCACGGGAATTACAAGTGACTCGAGTCACTTGTAATTCCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-2030s1c1
Sequence:CCGGGTGCACATCCTACGTTACTATCTCGAGATAGTAACGTAGGATGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2423s1c1
Sequence:CCGGCGCTGTCTCTTTGTCATCATTCTCGAGAATGATGACAAAGAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2626s1c1
Sequence:CCGGGCCAGAGTTGGATAAGCCAATCTCGAGATTGGCTTATCCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-3254s1c1
Sequence:CCGGGCAAGGCACAAGTCATACCTACTCGAGTAGGTATGACTTGTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2052s1c1
Sequence:CCGGCAAACTGCACAGCAGCATGAACTCGAGTTCATGCTGCTGTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1885s1c1
Sequence:CCGGGCTAAGTTTCCAGAGGTGTGTCTCGAGACACACCTCTGGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012468
TCL6 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia/lymphoma 6 (non-protein coding)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-1883s1c1
Sequence:CCGGCTGCTAAGTTTCCAGAGGTGTCTCGAGACACCTCTGGAAACTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1878s1c1
Sequence:CCGGCCTTCCTGCTAAGTTTCCAGACTCGAGTCTGGAAACTTAGCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2112s1c1
Sequence:CCGGGAAGACACAGCAAGTGAGAAACTCGAGTTTCTCACTTGCTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1821s1c1
Sequence:CCGGGATCACGGGAATTACAAGTGACTCGAGTCACTTGTAATTCCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-2030s1c1
Sequence:CCGGGTGCACATCCTACGTTACTATCTCGAGATAGTAACGTAGGATGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2423s1c1
Sequence:CCGGCGCTGTCTCTTTGTCATCATTCTCGAGAATGATGACAAAGAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2626s1c1
Sequence:CCGGGCCAGAGTTGGATAAGCCAATCTCGAGATTGGCTTATCCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-3254s1c1
Sequence:CCGGGCAAGGCACAAGTCATACCTACTCGAGTAGGTATGACTTGTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2052s1c1
Sequence:CCGGCAAACTGCACAGCAGCATGAACTCGAGTTCATGCTGCTGTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1885s1c1
Sequence:CCGGGCTAAGTTTCCAGAGGTGTGTCTCGAGACACACCTCTGGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012468
TCL6 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia/lymphoma 6 (non-protein coding)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-1883s1c1
Sequence:CCGGCTGCTAAGTTTCCAGAGGTGTCTCGAGACACCTCTGGAAACTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1878s1c1
Sequence:CCGGCCTTCCTGCTAAGTTTCCAGACTCGAGTCTGGAAACTTAGCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2112s1c1
Sequence:CCGGGAAGACACAGCAAGTGAGAAACTCGAGTTTCTCACTTGCTGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1821s1c1
Sequence:CCGGGATCACGGGAATTACAAGTGACTCGAGTCACTTGTAATTCCCGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012468.3-2030s1c1
Sequence:CCGGGTGCACATCCTACGTTACTATCTCGAGATAGTAACGTAGGATGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135856    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2423s1c1
Sequence:CCGGCGCTGTCTCTTTGTCATCATTCTCGAGAATGATGACAAAGAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-2626s1c1
Sequence:CCGGGCCAGAGTTGGATAAGCCAATCTCGAGATTGGCTTATCCAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012468.3-3254s1c1
Sequence:CCGGGCAAGGCACAAGTCATACCTACTCGAGTAGGTATGACTTGTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-2052s1c1
Sequence:CCGGCAAACTGCACAGCAGCATGAACTCGAGTTCATGCTGCTGTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012468.3-1885s1c1
Sequence:CCGGGCTAAGTTTCCAGAGGTGTGTCTCGAGACACACCTCTGGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks