EMAIL THIS PAGE TO A FRIEND

TCN1

transcobalamin I (vitamin B12 binding protein, R binder family)

Synonyms: TC-1 TC1 TCI
UniProtKB ID: P20061, A8KAC5, Q8WV77
Gene ID:
Human(6947) Summary: This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This protein is a major constituent of secondary granules in neutrophils and facilitates the transport of cobalamin into cells. [provided by RefSeq, Jul 2008]
cow(616239) transcobalamin I (vitamin B12 binding protein, R binder family)
sheep(101111999) transcobalamin I (vitamin B12 binding protein, R binder family)
naked mole-rat(101703835) transcobalamin I (vitamin B12 binding protein, R binder family)
domestic guinea pig(100734972) transcobalamin I (vitamin B12 binding protein, R binder family)
domestic cat(101099656) transcobalamin I (vitamin B12 binding protein, R binder family)
Horse(100058916) transcobalamin I (vitamin B12 binding protein, R binder family)
dog(612538) transcobalamin I (vitamin B12 binding protein, R binder family)
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001062 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142801 MISSION® esiRNA esiRNA human TCN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001062 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095544 predicted 1083
2 SASI_Hs01_00095546 predicted 381
3 SASI_Hs02_00311865 predicted 323
4 SASI_Hs01_00095547 predicted 689
5 SASI_Hs01_00095548 predicted 571
6 SASI_Hs01_00095549 predicted 1242
7 SASI_Hs02_00311866 predicted 681
8 SASI_Hs02_00311867 predicted 637
9 SASI_Hs02_00311868 predicted 882
10 SASI_Hs02_00311869 predicted 876
11 SASI_Hs01_00095545 predicted 308
12 SASI_Hs01_00095550 predicted 1116
13 SASI_Hs01_00095551 predicted 1130
14 SASI_Hs01_00095552 predicted 714
15 SASI_Hs01_00095553 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001062
TCN1 MISSION shRNA Bacterial Glycerol Stock
transcobalamin I (vitamin B12 binding protein, R binder family)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-1080s1c1
Sequence:CCGGCGTCAATTACTCTGTGAGAATCTCGAGATTCTCACAGAGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-999s1c1
Sequence:CCGGCGTCTCTGCTTCAGGTAACTTCTCGAGAAGTTACCTGAAGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-624s1c1
Sequence:CCGGCTCAGTAGATACTGGTGCAATCTCGAGATTGCACCAGTATCTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-825s1c1
Sequence:CCGGCCTCTTTGTATCATCAGACTACTCGAGTAGTCTGATGATACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-907s21c1
Sequence:CCGGATACAGTGCTCACGGAAATTTCTCGAGAAATTTCCGTGAGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-154s21c1
Sequence:CCGGCAAGCCAACTATGCGAGATTTCTCGAGAAATCTCGCATAGTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-985s21c1
Sequence:CCGGGAAAGACCTTCTTGGATATTACTCGAGTAATATCCAAGAAGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-1049s21c1
Sequence:CCGGCTCCGCTGATGAGCCTATAACCTCGAGGTTATAGGCTCATCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001062
TCN1 MISSION shRNA shRNA Plasmid DNA
transcobalamin I (vitamin B12 binding protein, R binder family)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-1080s1c1
Sequence:CCGGCGTCAATTACTCTGTGAGAATCTCGAGATTCTCACAGAGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-999s1c1
Sequence:CCGGCGTCTCTGCTTCAGGTAACTTCTCGAGAAGTTACCTGAAGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-624s1c1
Sequence:CCGGCTCAGTAGATACTGGTGCAATCTCGAGATTGCACCAGTATCTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-825s1c1
Sequence:CCGGCCTCTTTGTATCATCAGACTACTCGAGTAGTCTGATGATACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-907s21c1
Sequence:CCGGATACAGTGCTCACGGAAATTTCTCGAGAAATTTCCGTGAGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-154s21c1
Sequence:CCGGCAAGCCAACTATGCGAGATTTCTCGAGAAATCTCGCATAGTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-985s21c1
Sequence:CCGGGAAAGACCTTCTTGGATATTACTCGAGTAATATCCAAGAAGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-1049s21c1
Sequence:CCGGCTCCGCTGATGAGCCTATAACCTCGAGGTTATAGGCTCATCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001062
TCN1 MISSION shRNA Lentiviral Transduction Particles
transcobalamin I (vitamin B12 binding protein, R binder family)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-1080s1c1
Sequence:CCGGCGTCAATTACTCTGTGAGAATCTCGAGATTCTCACAGAGTAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-999s1c1
Sequence:CCGGCGTCTCTGCTTCAGGTAACTTCTCGAGAAGTTACCTGAAGCAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-624s1c1
Sequence:CCGGCTCAGTAGATACTGGTGCAATCTCGAGATTGCACCAGTATCTACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001062.2-825s1c1
Sequence:CCGGCCTCTTTGTATCATCAGACTACTCGAGTAGTCTGATGATACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-907s21c1
Sequence:CCGGATACAGTGCTCACGGAAATTTCTCGAGAAATTTCCGTGAGCACTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-154s21c1
Sequence:CCGGCAAGCCAACTATGCGAGATTTCTCGAGAAATCTCGCATAGTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-985s21c1
Sequence:CCGGGAAAGACCTTCTTGGATATTACTCGAGTAATATCCAAGAAGGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001062.3-1049s21c1
Sequence:CCGGCTCCGCTGATGAGCCTATAACCTCGAGGTTATAGGCTCATCAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks