EMAIL THIS PAGE TO A FRIEND

TCN2

transcobalamin II

Synonyms: D22S676 D22S750 II TC TC II TC-2 TC2 TCII
UniProtKB ID: P20062, Q96FD4, Q9BVI8, Q9UCI5, Q9UCI6, Q9UDM0
Gene ID:
Human(6948) Summary: This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(21452) transcobalamin 2
Rat(64365) transcobalamin 2
chicken(429737) transcobalamin II
domestic cat(101093303) transcobalamin II
dog(486355) transcobalamin II
domestic guinea pig(100734760) transcobalamin II
naked mole-rat(101722041) transcobalamin II
cow(281518) transcobalamin II
sheep(101112851) transcobalamin II
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000355 Rosetta Predictions human pricing
NM_022534 Rosetta Predictions rat pricing
NM_001130458 Rosetta Predictions mouse pricing
NM_001130459 Rosetta Predictions mouse pricing
NM_015749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159303 predicted 1245
2 SASI_Hs01_00159304 predicted 770
3 SASI_Hs01_00159305 predicted 897
4 SASI_Hs01_00159306 predicted 613
5 SASI_Hs01_00159307 predicted 1244
6 SASI_Hs01_00159309 predicted 781
7 SASI_Hs01_00159311 predicted 1412
8 SASI_Hs01_00159312 predicted 683
9 SASI_Hs02_00302399 predicted 1368
10 SASI_Hs02_00302400 predicted 1057
11 SASI_Hs01_00159308 predicted 1228
12 SASI_Hs01_00159310 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109074 predicted 1396
2 SASI_Rn01_00109075 predicted 666
3 SASI_Rn01_00109076 predicted 1308
4 SASI_Rn01_00109077 predicted 767
5 SASI_Rn01_00109078 predicted 668
6 SASI_Rn02_00263287 predicted 1373
7 SASI_Rn01_00109080 predicted 1424
8 SASI_Rn01_00109081 predicted 990
9 SASI_Rn01_00109082 predicted 1186
10 SASI_Rn01_00109083 predicted 665
11 SASI_Rn01_00109079 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311288 predicted 815
2 SASI_Mm02_00311289 predicted 1281
3 SASI_Mm02_00311290 predicted 287
4 SASI_Mm02_00311291 predicted 808
5 SASI_Mm02_00311292 predicted 271
6 SASI_Mm02_00311293 predicted 724
7 SASI_Mm02_00311294 predicted 838
8 SASI_Mm02_00311295 predicted 1342
9 SASI_Mm02_00311296 predicted 812
10 SASI_Mm02_00311297 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311298 predicted 776
2 SASI_Mm02_00311299 predicted 1254
3 SASI_Mm02_00311300 predicted 252
4 SASI_Mm02_00311301 predicted 780
5 SASI_Mm02_00311302 predicted 231
6 SASI_Mm02_00311303 predicted 695
7 SASI_Mm02_00311304 predicted 806
8 SASI_Mm02_00311305 predicted 1308
9 SASI_Mm02_00311306 predicted 785
10 SASI_Mm02_00311307 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187068 predicted 816
2 SASI_Mm01_00187069 predicted 1288
3 SASI_Mm01_00187070 predicted 288
4 SASI_Mm01_00187071 predicted 819
5 SASI_Mm01_00187072 predicted 266
6 SASI_Mm01_00187073 predicted 734
7 SASI_Mm01_00187074 predicted 838
8 SASI_Mm01_00187075 predicted 1343
9 SASI_Mm01_00187076 predicted 820
10 SASI_Mm01_00187077 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015749
VALIDATED
TCN2 MISSION shRNA Bacterial Glycerol Stock
transcobalamin II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1103s21c1
Sequence:CCGGCAAGACCTACTTGGATCTTATCTCGAGATAAGATCCAAGTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-831s21c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-744s21c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1349s21c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-458s21c1
Sequence:CCGGGTCCACCTCCAGCGATGATAACTCGAGTTATCATCGCTGGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015749.1-1651s1c1
Sequence:CCGGGCTCTTGACTTCCTCTACATACTCGAGTATGTAGAGGAAGTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-758s1c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015749.1-672s1c1
Sequence:CCGGCTGTTGAACATGACTACTTTACTCGAGTAAAGTAGTCATGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-671s1c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-1276s1c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015749
VALIDATED
TCN2 MISSION shRNA shRNA Plasmid DNA
transcobalamin II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1103s21c1
Sequence:CCGGCAAGACCTACTTGGATCTTATCTCGAGATAAGATCCAAGTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-831s21c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-744s21c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1349s21c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-458s21c1
Sequence:CCGGGTCCACCTCCAGCGATGATAACTCGAGTTATCATCGCTGGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015749.1-1651s1c1
Sequence:CCGGGCTCTTGACTTCCTCTACATACTCGAGTATGTAGAGGAAGTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-758s1c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015749.1-672s1c1
Sequence:CCGGCTGTTGAACATGACTACTTTACTCGAGTAAAGTAGTCATGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-671s1c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-1276s1c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015749
VALIDATED
TCN2 MISSION shRNA Lentiviral Transduction Particles
transcobalamin II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1103s21c1
Sequence:CCGGCAAGACCTACTTGGATCTTATCTCGAGATAAGATCCAAGTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-831s21c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-744s21c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-1349s21c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015749.3-458s21c1
Sequence:CCGGGTCCACCTCCAGCGATGATAACTCGAGTTATCATCGCTGGAGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015749.1-1651s1c1
Sequence:CCGGGCTCTTGACTTCCTCTACATACTCGAGTATGTAGAGGAAGTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-758s1c1
Sequence:CCGGCGATTCAATTTCAACTCTGATCTCGAGATCAGAGTTGAAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015749.1-672s1c1
Sequence:CCGGCTGTTGAACATGACTACTTTACTCGAGTAAAGTAGTCATGTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-671s1c1
Sequence:CCGGGCTGTTGAACATGACTACTTTCTCGAGAAAGTAGTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015749.1-1276s1c1
Sequence:CCGGCCTGACATCTGTACTAGGGAACTCGAGTTCCCTAGTACAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000355
TCN2 MISSION shRNA Bacterial Glycerol Stock
transcobalamin II
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-768s21c1
Sequence:CCGGACCTGTCTGAAGCGCTCAAACCTCGAGGTTTGAGCGCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-610s21c1
Sequence:CCGGACACTAGCTACTACCAGTATGCTCGAGCATACTGGTAGTAGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-536s21c1
Sequence:CCGGGCTGGTCTCACAGCTCAAATGCTCGAGCATTTGAGCTGTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1243s1c1
Sequence:CCGGCCCATGAGTTAGGAGGATTCACTCGAGTGAATCCTCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-205s1c1
Sequence:CCGGCCCTCACTGAGATGTGTGAAACTCGAGTTTCACACATCTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1044s1c1
Sequence:CCGGCTGAACCACAAGACCTACATTCTCGAGAATGTAGGTCTTGTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-564s1c1
Sequence:CCGGGAGGATGAGAAGAGAGCCATTCTCGAGAATGGCTCTCTTCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-680s1c1
Sequence:CCGGCGTGGTGGACAAACTTCTGTACTCGAGTACAGAAGTTTGTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000355
TCN2 MISSION shRNA shRNA Plasmid DNA
transcobalamin II
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-768s21c1
Sequence:CCGGACCTGTCTGAAGCGCTCAAACCTCGAGGTTTGAGCGCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-610s21c1
Sequence:CCGGACACTAGCTACTACCAGTATGCTCGAGCATACTGGTAGTAGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-536s21c1
Sequence:CCGGGCTGGTCTCACAGCTCAAATGCTCGAGCATTTGAGCTGTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1243s1c1
Sequence:CCGGCCCATGAGTTAGGAGGATTCACTCGAGTGAATCCTCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-205s1c1
Sequence:CCGGCCCTCACTGAGATGTGTGAAACTCGAGTTTCACACATCTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1044s1c1
Sequence:CCGGCTGAACCACAAGACCTACATTCTCGAGAATGTAGGTCTTGTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-564s1c1
Sequence:CCGGGAGGATGAGAAGAGAGCCATTCTCGAGAATGGCTCTCTTCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-680s1c1
Sequence:CCGGCGTGGTGGACAAACTTCTGTACTCGAGTACAGAAGTTTGTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000355
TCN2 MISSION shRNA Lentiviral Transduction Particles
transcobalamin II
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-768s21c1
Sequence:CCGGACCTGTCTGAAGCGCTCAAACCTCGAGGTTTGAGCGCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-610s21c1
Sequence:CCGGACACTAGCTACTACCAGTATGCTCGAGCATACTGGTAGTAGCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000355.2-536s21c1
Sequence:CCGGGCTGGTCTCACAGCTCAAATGCTCGAGCATTTGAGCTGTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1243s1c1
Sequence:CCGGCCCATGAGTTAGGAGGATTCACTCGAGTGAATCCTCCTAACTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-205s1c1
Sequence:CCGGCCCTCACTGAGATGTGTGAAACTCGAGTTTCACACATCTCAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-1044s1c1
Sequence:CCGGCTGAACCACAAGACCTACATTCTCGAGAATGTAGGTCTTGTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-564s1c1
Sequence:CCGGGAGGATGAGAAGAGAGCCATTCTCGAGAATGGCTCTCTTCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000355.2-680s1c1
Sequence:CCGGCGTGGTGGACAAACTTCTGTACTCGAGTACAGAAGTTTGTCCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks