EMAIL THIS PAGE TO A FRIEND

TCOF1

Treacher Collins-Franceschetti syndrome 1

Synonyms: MFD1 TCS1 treacle
Gene ID:
Human(6949) Summary: This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(21453) Treacher Collins Franceschetti syndrome 1, homolog
Rat(291571) Treacher Collins-Franceschetti syndrome 1
chicken(416276) Treacher Collins-Franceschetti syndrome 1
dog(403592) Treacher Collins-Franceschetti syndrome 1
Horse(100060348) Treacher Collins-Franceschetti syndrome 1
domestic cat(101083909) Treacher Collins-Franceschetti syndrome 1
cow(513591) Treacher Collins-Franceschetti syndrome 1
sheep(101110509) Treacher Collins-Franceschetti syndrome 1
naked mole-rat(101707739) Treacher Collins-Franceschetti syndrome 1
domestic guinea pig(100735220) Treacher Collins-Franceschetti syndrome 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000356 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000356 Rosetta Predictions human pricing
NM_001008656 Rosetta Predictions human pricing
NM_001008657 Rosetta Predictions human pricing
NM_001106143 Rosetta Predictions rat pricing
NM_011552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205815 predicted 1834
2 SASI_Hs01_00205816 predicted 1487
3 SASI_Hs01_00205817 predicted 473
4 SASI_Hs02_00302401 predicted 246
5 SASI_Hs01_00205818 predicted 232
6 SASI_Hs02_00302402 predicted 1320
7 SASI_Hs01_00205820 predicted 346
8 SASI_Hs02_00302403 predicted 1471
9 SASI_Hs01_00205821 predicted 1275
10 SASI_Hs01_00205822 predicted 1482
11 SASI_Hs01_00205819 predicted 471
12 SASI_Hs01_00205823 predicted 1626
13 SASI_Hs01_00205824 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205211 predicted 2067
2 SASI_Hs01_00205212 predicted 1721
3 SASI_Hs01_00205213 predicted 471
4 SASI_Hs02_00305512 predicted 253
5 SASI_Hs01_00205214 predicted 228
6 SASI_Hs02_00305513 predicted 1548
7 SASI_Hs01_00205216 predicted 344
8 SASI_Hs02_00305514 predicted 1706
9 SASI_Hs01_00205217 predicted 1506
10 SASI_Hs01_00205218 predicted 1712
11 SASI_Hs01_00205215 predicted 471
12 SASI_Hs01_00205219 predicted 1857
13 SASI_Hs01_00205220 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143977 predicted 2072
2 SASI_Hs01_00143978 predicted 1720
3 SASI_Hs01_00143979 predicted 476
4 SASI_Hs02_00305515 predicted 245
5 SASI_Hs01_00143980 predicted 233
6 SASI_Hs02_00305516 predicted 1549
7 SASI_Hs01_00143982 predicted 340
8 SASI_Hs02_00305517 predicted 1703
9 SASI_Hs01_00143983 predicted 1514
10 SASI_Hs01_00143984 predicted 1711
11 SASI_Hs01_00143981 predicted 470
12 SASI_Hs01_00143985 predicted 1859
13 SASI_Hs01_00143986 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216048 predicted 4382
2 SASI_Rn02_00216049 predicted 2495
3 SASI_Rn02_00216050 predicted 800
4 SASI_Rn02_00216051 predicted 491
5 SASI_Rn02_00216052 predicted 3034
6 SASI_Rn02_00216053 predicted 2153
7 SASI_Rn02_00216054 predicted 1830
8 SASI_Rn02_00216055 predicted 713
9 SASI_Rn02_00216056 predicted 3048
10 SASI_Rn02_00216057 predicted 2649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146732 predicted 3577
2 SASI_Mm01_00146733 predicted 3219
3 SASI_Mm01_00146734 predicted 2102
4 SASI_Mm02_00320906 predicted 417
5 SASI_Mm01_00146735 predicted 2579
6 SASI_Mm01_00146736 predicted 1720
7 SASI_Mm02_00320907 predicted 1095
8 SASI_Mm01_00146737 predicted 436
9 SASI_Mm01_00146738 predicted 1110
10 SASI_Mm01_00146740 predicted 477
11 SASI_Mm01_00146739 predicted 2720
12 SASI_Mm01_00146741 predicted 3408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011552
VALIDATED
TCOF1 MISSION shRNA Bacterial Glycerol Stock
Treacher Collins-Franceschetti syndrome 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011552.1-680s1c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-3141s1c1
Sequence:CCGGCCTACAGAATCCAGCGAAGATCTCGAGATCTTCGCTGGATTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-86s1c1
Sequence:CCGGCCTCATTTACCATCATCTGTTCTCGAGAACAGATGATGGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-2940s1c1
Sequence:CCGGGCCACCAACAAGCTCGGGAAACTCGAGTTTCCCGAGCTTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-85s1c1
Sequence:CCGGCCCTCATTTACCATCATCTGTCTCGAGACAGATGATGGTAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-2557s21c1
Sequence:CCGGCATCAGCCCAGGCGATTAAATCTCGAGATTTAATCGCCTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-3209s21c1
Sequence:CCGGCGGCTTGACTGTGGCTAATTCCTCGAGGAATTAGCCACAGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-1463s21c1
Sequence:CCGGAGCAGCTCTCAGGGTCCAAATCTCGAGATTTGGACCCTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-680s21c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-364s21c1
Sequence:CCGGCAAGACCGACACCTGTCAATTCTCGAGAATTGACAGGTGTCGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011552
VALIDATED
TCOF1 MISSION shRNA shRNA Plasmid DNA
Treacher Collins-Franceschetti syndrome 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011552.1-680s1c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-3141s1c1
Sequence:CCGGCCTACAGAATCCAGCGAAGATCTCGAGATCTTCGCTGGATTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-86s1c1
Sequence:CCGGCCTCATTTACCATCATCTGTTCTCGAGAACAGATGATGGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-2940s1c1
Sequence:CCGGGCCACCAACAAGCTCGGGAAACTCGAGTTTCCCGAGCTTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-85s1c1
Sequence:CCGGCCCTCATTTACCATCATCTGTCTCGAGACAGATGATGGTAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-2557s21c1
Sequence:CCGGCATCAGCCCAGGCGATTAAATCTCGAGATTTAATCGCCTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-3209s21c1
Sequence:CCGGCGGCTTGACTGTGGCTAATTCCTCGAGGAATTAGCCACAGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-1463s21c1
Sequence:CCGGAGCAGCTCTCAGGGTCCAAATCTCGAGATTTGGACCCTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-680s21c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-364s21c1
Sequence:CCGGCAAGACCGACACCTGTCAATTCTCGAGAATTGACAGGTGTCGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011552
VALIDATED
TCOF1 MISSION shRNA Lentiviral Transduction Particles
Treacher Collins-Franceschetti syndrome 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011552.1-680s1c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-3141s1c1
Sequence:CCGGCCTACAGAATCCAGCGAAGATCTCGAGATCTTCGCTGGATTCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-86s1c1
Sequence:CCGGCCTCATTTACCATCATCTGTTCTCGAGAACAGATGATGGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-2940s1c1
Sequence:CCGGGCCACCAACAAGCTCGGGAAACTCGAGTTTCCCGAGCTTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011552.1-85s1c1
Sequence:CCGGCCCTCATTTACCATCATCTGTCTCGAGACAGATGATGGTAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-2557s21c1
Sequence:CCGGCATCAGCCCAGGCGATTAAATCTCGAGATTTAATCGCCTGGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-3209s21c1
Sequence:CCGGCGGCTTGACTGTGGCTAATTCCTCGAGGAATTAGCCACAGTCAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-1463s21c1
Sequence:CCGGAGCAGCTCTCAGGGTCCAAATCTCGAGATTTGGACCCTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-680s21c1
Sequence:CCGGCGAGGTGAAATCTCCAGCAAACTCGAGTTTGCTGGAGATTTCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011552.2-364s21c1
Sequence:CCGGCAAGACCGACACCTGTCAATTCTCGAGAATTGACAGGTGTCGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000356
VALIDATED
TCOF1 MISSION shRNA Bacterial Glycerol Stock
Treacher Collins-Franceschetti syndrome 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-4554s1c1
Sequence:CCGGGACGCTTCATATAGATGTGTACTCGAGTACACATCTATATGAAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-204s1c1
Sequence:CCGGCGTAACCCTTCTGGACATCTACTCGAGTAGATGTCCAGAAGGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-381s1c1
Sequence:CCGGCCCAAGACTAGCATCTACCAACTCGAGTTGGTAGATGCTAGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-3550s1c1
Sequence:CCGGGCCGCCAAAGATGACCCAGATCTCGAGATCTGGGTCATCTTTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-1495s1c1
Sequence:CCGGGAGTCATCAGACAGCAGTGATCTCGAGATCACTGCTGTCTGATGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000356
VALIDATED
TCOF1 MISSION shRNA shRNA Plasmid DNA
Treacher Collins-Franceschetti syndrome 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-4554s1c1
Sequence:CCGGGACGCTTCATATAGATGTGTACTCGAGTACACATCTATATGAAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-204s1c1
Sequence:CCGGCGTAACCCTTCTGGACATCTACTCGAGTAGATGTCCAGAAGGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-381s1c1
Sequence:CCGGCCCAAGACTAGCATCTACCAACTCGAGTTGGTAGATGCTAGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-3550s1c1
Sequence:CCGGGCCGCCAAAGATGACCCAGATCTCGAGATCTGGGTCATCTTTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-1495s1c1
Sequence:CCGGGAGTCATCAGACAGCAGTGATCTCGAGATCACTGCTGTCTGATGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000356
VALIDATED
TCOF1 MISSION shRNA Lentiviral Transduction Particles
Treacher Collins-Franceschetti syndrome 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-4554s1c1
Sequence:CCGGGACGCTTCATATAGATGTGTACTCGAGTACACATCTATATGAAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-204s1c1
Sequence:CCGGCGTAACCCTTCTGGACATCTACTCGAGTAGATGTCCAGAAGGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-381s1c1
Sequence:CCGGCCCAAGACTAGCATCTACCAACTCGAGTTGGTAGATGCTAGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000356.1-3550s1c1
Sequence:CCGGGCCGCCAAAGATGACCCAGATCTCGAGATCTGGGTCATCTTTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000356.1-1495s1c1
Sequence:CCGGGAGTCATCAGACAGCAGTGATCTCGAGATCACTGCTGTCTGATGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks