EMAIL THIS PAGE TO A FRIEND

TCP10

t-complex 10

Synonyms: TCP10A
UniProtKB ID: Q12799, Q5JR60, Q6P4F4
Gene ID:
Mouse(21458) t-complex protein 10
Thale Cress(817659) transcription factor TCP10
Zebrafish(557345) t-complex protein 10
chicken(421567) t-complex 10 homolog (mouse)
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004610 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017037 predicted 899
2 SASI_Hs02_00337990 predicted 428
3 SASI_Hs02_00337991 predicted 999
4 SASI_Hs02_00337992 predicted 790
5 SASI_Hs02_00337993 predicted 996
6 SASI_Hs02_00337994 predicted 267
7 SASI_Hs02_00337995 predicted 914
8 SASI_Hs01_00017041 predicted 918
9 SASI_Hs02_00337996 predicted 905
10 SASI_Hs02_00337997 predicted 1016
11 SASI_Hs01_00017034 predicted 1265
12 SASI_Hs01_00017035 predicted 1282
13 SASI_Hs01_00017036 predicted 1332
14 SASI_Hs01_00017038 predicted 1381
15 SASI_Hs01_00017039 predicted 1178
16 SASI_Hs01_00017040 predicted 1288
17 SASI_Hs01_00017042 predicted 903
18 SASI_Hs01_00017043 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004610
TCP10 MISSION shRNA Bacterial Glycerol Stock
t-complex 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1202s1c1
Sequence:CCGGCGGGAGGGTTAAGATCAAAGACTCGAGTCTTTGATCTTAACCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-576s1c1
Sequence:CCGGCCAATGAGTTTAAAGACAGAACTCGAGTTCTGTCTTTAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1425s1c1
Sequence:CCGGCCTATTTAGGAAACTTGGTTACTCGAGTAACCAAGTTTCCTAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1873s1c1
Sequence:CCGGCCAGTTACTTACTTCTTTGTTCTCGAGAACAAAGAAGTAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-717s1c1
Sequence:CCGGGTGTCTGAAGACGGAAAGATTCTCGAGAATCTTTCCGTCTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-480s1c1
Sequence:CCGGGATGAAGAGACAACACCCAAACTCGAGTTTGGGTGTTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-567s1c1
Sequence:CCGGCCTCCAAAGCCAATGAGTTTACTCGAGTAAACTCATTGGCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-853s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-302s1c1
Sequence:CCGGCCAGAGTCATATGGATGCCTTCTCGAGAAGGCATCCATATGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004610
TCP10 MISSION shRNA shRNA Plasmid DNA
t-complex 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1202s1c1
Sequence:CCGGCGGGAGGGTTAAGATCAAAGACTCGAGTCTTTGATCTTAACCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-576s1c1
Sequence:CCGGCCAATGAGTTTAAAGACAGAACTCGAGTTCTGTCTTTAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1425s1c1
Sequence:CCGGCCTATTTAGGAAACTTGGTTACTCGAGTAACCAAGTTTCCTAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1873s1c1
Sequence:CCGGCCAGTTACTTACTTCTTTGTTCTCGAGAACAAAGAAGTAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-717s1c1
Sequence:CCGGGTGTCTGAAGACGGAAAGATTCTCGAGAATCTTTCCGTCTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-480s1c1
Sequence:CCGGGATGAAGAGACAACACCCAAACTCGAGTTTGGGTGTTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-567s1c1
Sequence:CCGGCCTCCAAAGCCAATGAGTTTACTCGAGTAAACTCATTGGCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-853s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-302s1c1
Sequence:CCGGCCAGAGTCATATGGATGCCTTCTCGAGAAGGCATCCATATGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004610
TCP10 MISSION shRNA Lentiviral Transduction Particles
t-complex 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1202s1c1
Sequence:CCGGCGGGAGGGTTAAGATCAAAGACTCGAGTCTTTGATCTTAACCCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-576s1c1
Sequence:CCGGCCAATGAGTTTAAAGACAGAACTCGAGTTCTGTCTTTAAACTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1425s1c1
Sequence:CCGGCCTATTTAGGAAACTTGGTTACTCGAGTAACCAAGTTTCCTAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160035    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004610.1-1873s1c1
Sequence:CCGGCCAGTTACTTACTTCTTTGTTCTCGAGAACAAAGAAGTAAGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-717s1c1
Sequence:CCGGGTGTCTGAAGACGGAAAGATTCTCGAGAATCTTTCCGTCTTCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-480s1c1
Sequence:CCGGGATGAAGAGACAACACCCAAACTCGAGTTTGGGTGTTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-567s1c1
Sequence:CCGGCCTCCAAAGCCAATGAGTTTACTCGAGTAAACTCATTGGCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-853s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004610.1-302s1c1
Sequence:CCGGCCAGAGTCATATGGATGCCTTCTCGAGAAGGCATCCATATGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks