EMAIL THIS PAGE TO A FRIEND

TCP10L2

t-complex 10-like 2

Synonyms: bA517H2.3
UniProtKB ID: B9ZVM9
Gene ID:
dog(100685628) t-complex 10-like 2 (mouse)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145121 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013683 Rosetta Predictions human pricing
XR_040749 Rosetta Predictions human pricing
XR_040750 Rosetta Predictions human pricing
XR_040751 Rosetta Predictions human pricing
XR_040752 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176670 predicted 903
2 SASI_Hs01_00176671 predicted 1264
3 SASI_Hs01_00176672 predicted 1279
4 SASI_Hs01_00176673 predicted 774
5 SASI_Hs01_00176674 predicted 1174
6 SASI_Hs01_00176675 predicted 1038
7 SASI_Hs01_00176676 predicted 1288
8 SASI_Hs01_00176677 predicted 924
9 SASI_Hs01_00176678 predicted 904
10 SASI_Hs01_00176679 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521591 predicted 898
2 SASI_Hs02_00521592 predicted 1269
3 SASI_Hs02_00521593 predicted 765
4 SASI_Hs02_00521594 predicted 1175
5 SASI_Hs02_00521595 predicted 1036
6 SASI_Hs02_00521596 predicted 1278
7 SASI_Hs02_00521597 predicted 921
8 SASI_Hs02_00521598 predicted 900
9 SASI_Hs02_00521599 predicted 798
10 SASI_Hs02_00521600 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521601 predicted 898
2 SASI_Hs02_00521602 predicted 1629
3 SASI_Hs02_00521603 predicted 1005
4 SASI_Hs02_00521604 predicted 1617
5 SASI_Hs02_00521605 predicted 993
6 SASI_Hs02_00521606 predicted 1661
7 SASI_Hs02_00521607 predicted 1508
8 SASI_Hs02_00521608 predicted 1627
9 SASI_Hs02_00521609 predicted 1613
10 SASI_Hs02_00521610 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521611 predicted 894
2 SASI_Hs02_00521612 predicted 1265
3 SASI_Hs02_00521613 predicted 770
4 SASI_Hs02_00521614 predicted 1174
5 SASI_Hs02_00521615 predicted 1033
6 SASI_Hs02_00521616 predicted 1284
7 SASI_Hs02_00521617 predicted 920
8 SASI_Hs02_00521618 predicted 898
9 SASI_Hs02_00521619 predicted 931
10 SASI_Hs02_00521620 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521621 predicted 895
2 SASI_Hs02_00521622 predicted 1629
3 SASI_Hs02_00521623 predicted 998
4 SASI_Hs02_00521624 predicted 1625
5 SASI_Hs02_00521625 predicted 999
6 SASI_Hs02_00521626 predicted 1661
7 SASI_Hs02_00521627 predicted 1510
8 SASI_Hs02_00521628 predicted 1629
9 SASI_Hs02_00521629 predicted 1616
10 SASI_Hs02_00521630 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013683
TCP10L2 MISSION shRNA Bacterial Glycerol Stock
t-complex 10-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-892s1c1
Sequence:CCGGGAGTTGCTGACAGAAGCTCATCTCGAGATGAGCTTCTGTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-907s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1328s1c1
Sequence:CCGGGCATCACATGGGAAATGCCAACTCGAGTTGGCATTTCCCATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-777s1c1
Sequence:CCGGGAAGACGGAAAGATTATGCATCTCGAGATGCATAATCTTTCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1076s1c1
Sequence:CCGGGAAGAGACCTTATTTCCTGATCTCGAGATCAGGAAATAAGGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1083s1c1
Sequence:CCGGCCTTATTTCCTGATGGGACAACTCGAGTTGTCCCATCAGGAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-1023s1c1
Sequence:CCGGCCAAAGAAATCGTGTTTCCCACTCGAGTGGGAAACACGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013683
TCP10L2 MISSION shRNA shRNA Plasmid DNA
t-complex 10-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-892s1c1
Sequence:CCGGGAGTTGCTGACAGAAGCTCATCTCGAGATGAGCTTCTGTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-907s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1328s1c1
Sequence:CCGGGCATCACATGGGAAATGCCAACTCGAGTTGGCATTTCCCATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-777s1c1
Sequence:CCGGGAAGACGGAAAGATTATGCATCTCGAGATGCATAATCTTTCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1076s1c1
Sequence:CCGGGAAGAGACCTTATTTCCTGATCTCGAGATCAGGAAATAAGGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1083s1c1
Sequence:CCGGCCTTATTTCCTGATGGGACAACTCGAGTTGTCCCATCAGGAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-1023s1c1
Sequence:CCGGCCAAAGAAATCGTGTTTCCCACTCGAGTGGGAAACACGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013683
TCP10L2 MISSION shRNA Lentiviral Transduction Particles
t-complex 10-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-892s1c1
Sequence:CCGGGAGTTGCTGACAGAAGCTCATCTCGAGATGAGCTTCTGTCAGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013683.1-907s1c1
Sequence:CCGGGCTCATCAGTCTTAGGGAGTTCTCGAGAACTCCCTAAGACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1328s1c1
Sequence:CCGGGCATCACATGGGAAATGCCAACTCGAGTTGGCATTTCCCATGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-777s1c1
Sequence:CCGGGAAGACGGAAAGATTATGCATCTCGAGATGCATAATCTTTCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1076s1c1
Sequence:CCGGGAAGAGACCTTATTTCCTGATCTCGAGATCAGGAAATAAGGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013683.1-1083s1c1
Sequence:CCGGCCTTATTTCCTGATGGGACAACTCGAGTTGTCCCATCAGGAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013683.1-1023s1c1
Sequence:CCGGCCAAAGAAATCGTGTTTCCCACTCGAGTGGGAAACACGATTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145121
TCP10L2 MISSION shRNA Bacterial Glycerol Stock
t-complex 10-like 2
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000433227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1320s21c1
Sequence:CCGGTATCTTCCAGCCACCACATTTCTCGAGAAATGTGGTGGCTGGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1671s21c1
Sequence:CCGGGCTACTTGCAGTAACAGTTTGCTCGAGCAAACTGTTACTGCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145121
TCP10L2 MISSION shRNA shRNA Plasmid DNA
t-complex 10-like 2
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000433227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1320s21c1
Sequence:CCGGTATCTTCCAGCCACCACATTTCTCGAGAAATGTGGTGGCTGGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1671s21c1
Sequence:CCGGGCTACTTGCAGTAACAGTTTGCTCGAGCAAACTGTTACTGCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145121
TCP10L2 MISSION shRNA Lentiviral Transduction Particles
t-complex 10-like 2
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000433227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1320s21c1
Sequence:CCGGTATCTTCCAGCCACCACATTTCTCGAGAAATGTGGTGGCTGGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145121.1-1671s21c1
Sequence:CCGGGCTACTTGCAGTAACAGTTTGCTCGAGCAAACTGTTACTGCAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks