EMAIL THIS PAGE TO A FRIEND

TCP10L

t-complex 10-like

Synonyms: C21orf77 TCP10A-2
Species: Human TCP10L(140290)
UniProtKB ID: Q8TDR4, Q53EW0, Q96LN5
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143867 predicted 626
2 SASI_Hs01_00143868 predicted 339
3 SASI_Hs01_00143869 predicted 718
4 SASI_Hs01_00143870 predicted 571
5 SASI_Hs01_00143871 predicted 350
6 SASI_Hs01_00143872 predicted 305
7 SASI_Hs01_00143873 predicted 365
8 SASI_Hs01_00143874 predicted 410
9 SASI_Hs01_00143875 predicted 544
10 SASI_Hs01_00143876 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144659
TCP10L MISSION shRNA Bacterial Glycerol Stock
t-complex 10-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-604s1c1
Sequence:CCGGGAAAGAATTAGCTCGTGGAAACTCGAGTTTCCACGAGCTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-490s1c1
Sequence:CCGGGATGAAGAGACAATACCCAAACTCGAGTTTGGGTATTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144659.3-799s1c1
Sequence:CCGGCAGATAAAGTTCCACTTAGGTCTCGAGACCTAAGTGGAACTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-288s1c1
Sequence:CCGGGTGGGCTGATGTTCATGGAAACTCGAGTTTCCATGAACATCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-677s1c1
Sequence:CCGGGAAGAGCAACACCTACTGGAACTCGAGTTCCAGTAGGTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144659
TCP10L MISSION shRNA shRNA Plasmid DNA
t-complex 10-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-604s1c1
Sequence:CCGGGAAAGAATTAGCTCGTGGAAACTCGAGTTTCCACGAGCTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-490s1c1
Sequence:CCGGGATGAAGAGACAATACCCAAACTCGAGTTTGGGTATTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144659.3-799s1c1
Sequence:CCGGCAGATAAAGTTCCACTTAGGTCTCGAGACCTAAGTGGAACTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-288s1c1
Sequence:CCGGGTGGGCTGATGTTCATGGAAACTCGAGTTTCCATGAACATCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-677s1c1
Sequence:CCGGGAAGAGCAACACCTACTGGAACTCGAGTTCCAGTAGGTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144659
TCP10L MISSION shRNA Lentiviral Transduction Particles
t-complex 10-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-604s1c1
Sequence:CCGGGAAAGAATTAGCTCGTGGAAACTCGAGTTTCCACGAGCTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-490s1c1
Sequence:CCGGGATGAAGAGACAATACCCAAACTCGAGTTTGGGTATTGTCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144659.3-799s1c1
Sequence:CCGGCAGATAAAGTTCCACTTAGGTCTCGAGACCTAAGTGGAACTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-288s1c1
Sequence:CCGGGTGGGCTGATGTTCATGGAAACTCGAGTTTCCATGAACATCAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144659.1-677s1c1
Sequence:CCGGGAAGAGCAACACCTACTGGAACTCGAGTTCCAGTAGGTGTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks