EMAIL THIS PAGE TO A FRIEND

TCP11

t-complex 11, testis-specific

Synonyms: D6S230E FPPR
Gene ID:
Mouse(21463) t-complex protein 11
Rat(309641) t-complex protein 11
chicken(419897) t-complex 11 homolog (mouse)
dog(474883) t-complex 11, testis-specific
Horse(100062952) t-complex 11, testis-specific
domestic cat(101097395) t-complex 11, testis-specific
cow(523297) t-complex 11 homolog (mouse)
cow(522334) t-complex 11 homolog (mouse)
sheep(101121213) t-complex 11, testis-specific
domestic guinea pig(100732036) t-complex 11, testis-specific
Domestic Rabbit(100358534) t-complex 11, testis-specific
naked mole-rat(101725779) t-complex 11, testis-specific
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018679 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093728 Rosetta Predictions human pricing
NM_018679 Rosetta Predictions human pricing
NM_001007695 Rosetta Predictions rat pricing
NM_001085555 Rosetta Predictions mouse pricing
NM_013687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318113 predicted 1301
2 SASI_Hs02_00318114 predicted 1650
3 SASI_Hs02_00318115 predicted 1203
4 SASI_Hs02_00318116 predicted 734
5 SASI_Hs02_00318117 predicted 1410
6 SASI_Hs02_00318118 predicted 1376
7 SASI_Hs02_00318119 predicted 1292
8 SASI_Hs02_00318120 predicted 1423
9 SASI_Hs02_00318121 predicted 689
10 SASI_Hs02_00318122 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145348 predicted 1389
2 SASI_Hs01_00145349 predicted 1749
3 SASI_Hs01_00145350 predicted 1290
4 SASI_Hs01_00145351 predicted 832
5 SASI_Hs01_00145352 predicted 1504
6 SASI_Hs02_00352192 predicted 1476
7 SASI_Hs01_00145353 predicted 1387
8 SASI_Hs01_00145354 predicted 1516
9 SASI_Hs01_00145355 predicted 779
10 SASI_Hs01_00145356 predicted 978
11 SASI_Hs01_00145357 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035980 predicted 435
2 SASI_Rn01_00035981 predicted 1314
3 SASI_Rn01_00035982 predicted 1452
4 SASI_Rn01_00035984 predicted 975
5 SASI_Rn01_00035985 predicted 1679
6 SASI_Rn01_00035986 predicted 1387
7 SASI_Rn01_00035987 predicted 449
8 SASI_Rn01_00035988 predicted 1236
9 SASI_Rn01_00035989 predicted 1392
10 SASI_Rn02_00198852 predicted 1301
11 SASI_Rn01_00035983 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301019 predicted 548
2 SASI_Mm02_00301020 predicted 526
3 SASI_Mm02_00301021 predicted 908
4 SASI_Mm02_00301022 predicted 1432
5 SASI_Mm02_00301023 predicted 1420
6 SASI_Mm02_00301024 predicted 1162
7 SASI_Mm02_00301025 predicted 704
8 SASI_Mm02_00301026 predicted 1313
9 SASI_Mm02_00301027 predicted 1239
10 SASI_Mm02_00301028 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060271 predicted 781
2 SASI_Mm01_00060272 predicted 763
3 SASI_Mm02_00322569 predicted 1144
4 SASI_Mm02_00322570 predicted 1669
5 SASI_Mm02_00322571 predicted 1664
6 SASI_Mm01_00060275 predicted 1401
7 SASI_Mm02_00322572 predicted 941
8 SASI_Mm02_00322573 predicted 1553
9 SASI_Mm02_00322574 predicted 1472
10 SASI_Mm01_00060278 predicted 1211
11 SASI_Mm01_00060270 predicted 1702
12 SASI_Mm01_00060273 predicted 447
13 SASI_Mm01_00060274 predicted 1544
14 SASI_Mm01_00060276 predicted 534
15 SASI_Mm01_00060277 predicted 478
16 SASI_Mm01_00060279 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018679
TCP11 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1634s21c1
Sequence:CCGGTGGTGTGCAGCGGTCTCTATTCTCGAGAATAGAGACCGCTGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1507s21c1
Sequence:CCGGTTGCTCTAAGCAGTGATAATACTCGAGTATTATCACTGCTTAGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1285s21c1
Sequence:CCGGAGTCCCAGTTGCACCAGTTAACTCGAGTTAACTGGTGCAACTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1754s21c1
Sequence:CCGGCTACTACACTGAGATCCTAAACTCGAGTTTAGGATCTCAGTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1590s21c1
Sequence:CCGGATTGATCAGCGGATCCATTTGCTCGAGCAAATGGATCCGCTGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-927s21c1
Sequence:CCGGGACATGGTGAACTACACTATCCTCGAGGATAGTGTAGTTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-776s1c1
Sequence:CCGGCGAGATGAAGCAGTGCAGAAACTCGAGTTTCTGCACTGCTTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-1327s1c1
Sequence:CCGGGAAACGCATAACCAAATCCTTCTCGAGAAGGATTTGGTTATGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-643s1c1
Sequence:CCGGCCGCCTGAGAATTGAGATTGACTCGAGTCAATCTCAATTCTCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-918s1c1
Sequence:CCGGCCATTCAGTATGAACGGGCTACTCGAGTAGCCCGTTCATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018679
TCP11 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1634s21c1
Sequence:CCGGTGGTGTGCAGCGGTCTCTATTCTCGAGAATAGAGACCGCTGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1507s21c1
Sequence:CCGGTTGCTCTAAGCAGTGATAATACTCGAGTATTATCACTGCTTAGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1285s21c1
Sequence:CCGGAGTCCCAGTTGCACCAGTTAACTCGAGTTAACTGGTGCAACTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1754s21c1
Sequence:CCGGCTACTACACTGAGATCCTAAACTCGAGTTTAGGATCTCAGTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1590s21c1
Sequence:CCGGATTGATCAGCGGATCCATTTGCTCGAGCAAATGGATCCGCTGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-927s21c1
Sequence:CCGGGACATGGTGAACTACACTATCCTCGAGGATAGTGTAGTTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-776s1c1
Sequence:CCGGCGAGATGAAGCAGTGCAGAAACTCGAGTTTCTGCACTGCTTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-1327s1c1
Sequence:CCGGGAAACGCATAACCAAATCCTTCTCGAGAAGGATTTGGTTATGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-643s1c1
Sequence:CCGGCCGCCTGAGAATTGAGATTGACTCGAGTCAATCTCAATTCTCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-918s1c1
Sequence:CCGGCCATTCAGTATGAACGGGCTACTCGAGTAGCCCGTTCATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018679
TCP11 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1634s21c1
Sequence:CCGGTGGTGTGCAGCGGTCTCTATTCTCGAGAATAGAGACCGCTGCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1507s21c1
Sequence:CCGGTTGCTCTAAGCAGTGATAATACTCGAGTATTATCACTGCTTAGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1285s21c1
Sequence:CCGGAGTCCCAGTTGCACCAGTTAACTCGAGTTAACTGGTGCAACTGGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1754s21c1
Sequence:CCGGCTACTACACTGAGATCCTAAACTCGAGTTTAGGATCTCAGTGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-1590s21c1
Sequence:CCGGATTGATCAGCGGATCCATTTGCTCGAGCAAATGGATCCGCTGATCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018679.4-927s21c1
Sequence:CCGGGACATGGTGAACTACACTATCCTCGAGGATAGTGTAGTTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-776s1c1
Sequence:CCGGCGAGATGAAGCAGTGCAGAAACTCGAGTTTCTGCACTGCTTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-1327s1c1
Sequence:CCGGGAAACGCATAACCAAATCCTTCTCGAGAAGGATTTGGTTATGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-643s1c1
Sequence:CCGGCCGCCTGAGAATTGAGATTGACTCGAGTCAATCTCAATTCTCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018679.2-918s1c1
Sequence:CCGGCCATTCAGTATGAACGGGCTACTCGAGTAGCCCGTTCATACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013687
TCP11 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1698s1c1
Sequence:CCGGCCCGTATTACACCGAGATCTTCTCGAGAAGATCTCGGTGTAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1545s1c1
Sequence:CCGGGCGTATACACTTGTTCCTCAACTCGAGTTGAGGAACAAGTGTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-732s1c1
Sequence:CCGGCTCCTACCTCTCCAAGTATATCTCGAGATATACTTGGAGAGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1180s1c1
Sequence:CCGGGAAGAGTTTCCTGAAACCCTACTCGAGTAGGGTTTCAGGAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-460s1c1
Sequence:CCGGCTTGATTGTCAGTTGGAAGAACTCGAGTTCTTCCAACTGACAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013687
TCP11 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1698s1c1
Sequence:CCGGCCCGTATTACACCGAGATCTTCTCGAGAAGATCTCGGTGTAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1545s1c1
Sequence:CCGGGCGTATACACTTGTTCCTCAACTCGAGTTGAGGAACAAGTGTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-732s1c1
Sequence:CCGGCTCCTACCTCTCCAAGTATATCTCGAGATATACTTGGAGAGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1180s1c1
Sequence:CCGGGAAGAGTTTCCTGAAACCCTACTCGAGTAGGGTTTCAGGAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-460s1c1
Sequence:CCGGCTTGATTGTCAGTTGGAAGAACTCGAGTTCTTCCAACTGACAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013687
TCP11 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1698s1c1
Sequence:CCGGCCCGTATTACACCGAGATCTTCTCGAGAAGATCTCGGTGTAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1545s1c1
Sequence:CCGGGCGTATACACTTGTTCCTCAACTCGAGTTGAGGAACAAGTGTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-732s1c1
Sequence:CCGGCTCCTACCTCTCCAAGTATATCTCGAGATATACTTGGAGAGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-1180s1c1
Sequence:CCGGGAAGAGTTTCCTGAAACCCTACTCGAGTAGGGTTTCAGGAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013687.2-460s1c1
Sequence:CCGGCTTGATTGTCAGTTGGAAGAACTCGAGTTCTTCCAACTGACAATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks