EMAIL THIS PAGE TO A FRIEND

TCP11L1

t-complex 11, testis-specific-like 1

Synonyms: dJ85M6.3
UniProtKB ID: Q9NUJ3, D3DR01, Q8IVX4
Gene ID:
Mouse(320554) t-complex 11 like 1
Rat(499846) t-complex 11, testis-specific-like 1
naked mole-rat(101713710) t-complex 11, testis-specific-like 1
Domestic Rabbit(100338548) t-complex 11, testis-specific-like 1
domestic guinea pig(100727554) t-complex 11, testis-specific-like 1
cow(508910) t-complex 11 (mouse)-like 1
sheep(101122886) t-complex 11, testis-specific-like 1
Zebrafish(541488) t-complex 11 (mouse)-like 1
chicken(421594) t-complex 11 (mouse)-like 1
domestic cat(101089716) t-complex 11, testis-specific-like 1
dog(609152) t-complex 11, testis-specific-like 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005769 Anti-TCP11L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018393 Rosetta Predictions human pricing
NM_001109202 Rosetta Predictions rat pricing
NM_177190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168920 predicted 526
2 SASI_Hs01_00168921 predicted 1762
3 SASI_Hs01_00168922 predicted 1823
4 SASI_Hs01_00168923 predicted 376
5 SASI_Hs01_00168924 predicted 505
6 SASI_Hs01_00168925 predicted 592
7 SASI_Hs01_00168926 predicted 477
8 SASI_Hs01_00168927 predicted 986
9 SASI_Hs01_00168928 predicted 1548
10 SASI_Hs01_00168929 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246100 predicted 857
2 SASI_Rn02_00246101 predicted 479
3 SASI_Rn02_00246102 predicted 450
4 SASI_Rn02_00246103 predicted 946
5 SASI_Rn02_00246104 predicted 534
6 SASI_Rn02_00246105 predicted 536
7 SASI_Rn02_00246106 predicted 1559
8 SASI_Rn02_00246107 predicted 367
9 SASI_Rn02_00246108 predicted 984
10 SASI_Rn02_00246109 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132790 predicted 467
2 SASI_Mm01_00132791 predicted 1823
3 SASI_Mm01_00132792 predicted 739
4 SASI_Mm01_00132793 predicted 1277
5 SASI_Mm01_00132794 predicted 381
6 SASI_Mm01_00132795 predicted 527
7 SASI_Mm01_00132796 predicted 440
8 SASI_Mm01_00132797 predicted 818
9 SASI_Mm01_00132798 predicted 523
10 SASI_Mm01_00132799 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018393
VALIDATED
TCP11L1 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1706s1c1
Sequence:CCGGCCTACTACGATGCAATCCTGACTCGAGTCAGGATTGCATCGTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018393.2-1535s1c1
Sequence:CCGGGCAGGATCATGGAATCTCGAACTCGAGTTCGAGATTCCATGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1644s1c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1860s1c1
Sequence:CCGGCCGATTCCAAAGGGAAGAATACTCGAGTATTCTTCCCTTTGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1861s1c1
Sequence:CCGGCGATTCCAAAGGGAAGAATATCTCGAGATATTCTTCCCTTTGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-673s1c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018393.2-1552s1c1
Sequence:CCGGCGAATCCTGACCTTCTTAGAACTCGAGTTCTAAGAAGGTCAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-451s1c1
Sequence:CCGGCTAGCCCATGAAATTGTAGTACTCGAGTACTACAATTTCATGGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1669s21c1
Sequence:CCGGGCTCGCCTGGTCAACTATAACCTCGAGGTTATAGTTGACCAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018393.2-2201s21c1
Sequence:CCGGTTTGTTAGAAGGGCTATATAACTCGAGTTATATAGCCCTTCTAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1737s21c1
Sequence:CCGGCGTCCGATCCTAACGTGTATGCTCGAGCATACACGTTAGGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018393.2-1644s21c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-673s21c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018393
VALIDATED
TCP11L1 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1706s1c1
Sequence:CCGGCCTACTACGATGCAATCCTGACTCGAGTCAGGATTGCATCGTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018393.2-1535s1c1
Sequence:CCGGGCAGGATCATGGAATCTCGAACTCGAGTTCGAGATTCCATGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1644s1c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1860s1c1
Sequence:CCGGCCGATTCCAAAGGGAAGAATACTCGAGTATTCTTCCCTTTGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1861s1c1
Sequence:CCGGCGATTCCAAAGGGAAGAATATCTCGAGATATTCTTCCCTTTGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-673s1c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018393.2-1552s1c1
Sequence:CCGGCGAATCCTGACCTTCTTAGAACTCGAGTTCTAAGAAGGTCAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-451s1c1
Sequence:CCGGCTAGCCCATGAAATTGTAGTACTCGAGTACTACAATTTCATGGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1669s21c1
Sequence:CCGGGCTCGCCTGGTCAACTATAACCTCGAGGTTATAGTTGACCAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018393.2-2201s21c1
Sequence:CCGGTTTGTTAGAAGGGCTATATAACTCGAGTTATATAGCCCTTCTAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1737s21c1
Sequence:CCGGCGTCCGATCCTAACGTGTATGCTCGAGCATACACGTTAGGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018393.2-1644s21c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-673s21c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018393
VALIDATED
TCP11L1 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1706s1c1
Sequence:CCGGCCTACTACGATGCAATCCTGACTCGAGTCAGGATTGCATCGTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018393.2-1535s1c1
Sequence:CCGGGCAGGATCATGGAATCTCGAACTCGAGTTCGAGATTCCATGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-1644s1c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1860s1c1
Sequence:CCGGCCGATTCCAAAGGGAAGAATACTCGAGTATTCTTCCCTTTGGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129700    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018393.2-1861s1c1
Sequence:CCGGCGATTCCAAAGGGAAGAATATCTCGAGATATTCTTCCCTTTGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-673s1c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018393.2-1552s1c1
Sequence:CCGGCGAATCCTGACCTTCTTAGAACTCGAGTTCTAAGAAGGTCAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018393.2-451s1c1
Sequence:CCGGCTAGCCCATGAAATTGTAGTACTCGAGTACTACAATTTCATGGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1669s21c1
Sequence:CCGGGCTCGCCTGGTCAACTATAACCTCGAGGTTATAGTTGACCAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018393.2-2201s21c1
Sequence:CCGGTTTGTTAGAAGGGCTATATAACTCGAGTTATATAGCCCTTCTAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-1737s21c1
Sequence:CCGGCGTCCGATCCTAACGTGTATGCTCGAGCATACACGTTAGGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018393.2-1644s21c1
Sequence:CCGGGCTGGAGGAAGTTGCTATTAACTCGAGTTAATAGCAACTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018393.2-673s21c1
Sequence:CCGGCTGAGAAACCAGATAACAGAACTCGAGTTCTGTTATCTGGTTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177190
TCP11L1 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific-like 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-614s1c1
Sequence:CCGGGAGATCAAAGAGACTCTGTTACTCGAGTAACAGAGTCTCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-657s1c1
Sequence:CCGGCTAGACTAAGAAACCAGATAACTCGAGTTATCTGGTTTCTTAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1130s1c1
Sequence:CCGGGCCTACCTGAAGCTTCTGAAACTCGAGTTTCAGAAGCTTCAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-443s1c1
Sequence:CCGGGCCCATGAAATTGTAGTAACTCTCGAGAGTTACTACAATTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1663s1c1
Sequence:CCGGCCTGGTCAACTATAACAAGATCTCGAGATCTTGTTATAGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177190.5-833s21c1
Sequence:CCGGGCCTCTCTTCAGGGCAATATTCTCGAGAATATTGCCCTGAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177190
TCP11L1 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific-like 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-614s1c1
Sequence:CCGGGAGATCAAAGAGACTCTGTTACTCGAGTAACAGAGTCTCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-657s1c1
Sequence:CCGGCTAGACTAAGAAACCAGATAACTCGAGTTATCTGGTTTCTTAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1130s1c1
Sequence:CCGGGCCTACCTGAAGCTTCTGAAACTCGAGTTTCAGAAGCTTCAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-443s1c1
Sequence:CCGGGCCCATGAAATTGTAGTAACTCTCGAGAGTTACTACAATTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1663s1c1
Sequence:CCGGCCTGGTCAACTATAACAAGATCTCGAGATCTTGTTATAGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177190.5-833s21c1
Sequence:CCGGGCCTCTCTTCAGGGCAATATTCTCGAGAATATTGCCCTGAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177190
TCP11L1 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific-like 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-614s1c1
Sequence:CCGGGAGATCAAAGAGACTCTGTTACTCGAGTAACAGAGTCTCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-657s1c1
Sequence:CCGGCTAGACTAAGAAACCAGATAACTCGAGTTATCTGGTTTCTTAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1130s1c1
Sequence:CCGGGCCTACCTGAAGCTTCTGAAACTCGAGTTTCAGAAGCTTCAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-443s1c1
Sequence:CCGGGCCCATGAAATTGTAGTAACTCTCGAGAGTTACTACAATTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177190.2-1663s1c1
Sequence:CCGGCCTGGTCAACTATAACAAGATCTCGAGATCTTGTTATAGTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177190.5-833s21c1
Sequence:CCGGGCCTCTCTTCAGGGCAATATTCTCGAGAATATTGCCCTGAAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks