EMAIL THIS PAGE TO A FRIEND

TCP11L2

t-complex 11, testis-specific-like 2

UniProtKB ID: Q8N4U5
Gene ID:
Mouse(216198) t-complex 11 (mouse) like 2
Rat(314683) t-complex 11, testis-specific-like 2
Zebrafish(406293) t-complex 11 (mouse)-like 2
chicken(425052) t-complex 11 (mouse)-like 2
domestic cat(101087246) t-complex 11, testis-specific-like 2
dog(474532) t-complex 11, testis-specific-like 2
cow(541012) t-complex 11 (mouse)-like 2
sheep(101115200) t-complex 11, testis-specific-like 2
domestic guinea pig(100720562) t-complex 11, testis-specific-like 2
Domestic Rabbit(100348731) t-complex 11, testis-specific-like 2
naked mole-rat(101725508) t-complex 11, testis-specific-like 2
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152772 Rosetta Predictions human pricing
NM_001017458 Rosetta Predictions rat pricing
NM_146008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220381 predicted 1470
2 SASI_Hs01_00220383 predicted 1122
3 SASI_Hs01_00220384 predicted 1668
4 SASI_Hs01_00220385 predicted 1819
5 SASI_Hs02_00366712 predicted 1739
6 SASI_Hs01_00220386 predicted 1420
7 SASI_Hs02_00366713 predicted 1627
8 SASI_Hs01_00220387 predicted 1788
9 SASI_Hs01_00220388 predicted 1737
10 SASI_Hs01_00220389 predicted 243
11 SASI_Hs01_00220380 predicted 957
12 SASI_Hs01_00220382 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087712 predicted 777
2 SASI_Rn01_00087713 predicted 621
3 SASI_Rn01_00087714 predicted 1578
4 SASI_Rn01_00087715 predicted 298
5 SASI_Rn01_00087716 predicted 1187
6 SASI_Rn01_00087717 predicted 1303
7 SASI_Rn01_00087718 predicted 1000
8 SASI_Rn01_00087719 predicted 727
9 SASI_Rn01_00087720 predicted 1682
10 SASI_Rn02_00202254 predicted 1688
11 SASI_Rn01_00087721 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341550 predicted 930
2 SASI_Mm01_00071745 predicted 1179
3 SASI_Mm01_00071746 predicted 1740
4 SASI_Mm01_00071747 predicted 1385
5 SASI_Mm01_00071748 predicted 1158
6 SASI_Mm01_00071749 predicted 1779
7 SASI_Mm01_00071750 predicted 1370
8 SASI_Mm01_00071751 predicted 1786
9 SASI_Mm01_00071752 predicted 1333
10 SASI_Mm01_00071753 predicted 1012
11 SASI_Mm01_00071754 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152772
TCP11L2 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-886s1c1
Sequence:CCGGCAACGCCAGTTGGTGGAATATCTCGAGATATTCCACCAACTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1680s1c1
Sequence:CCGGGCTCTTCAATGAGGAAGCCATCTCGAGATGGCTTCCTCATTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1788s1c1
Sequence:CCGGCCACTTCCATTGATGGCATTACTCGAGTAATGCCATCAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1414s1c1
Sequence:CCGGGCTGAGATTCAAGCTAATCTTCTCGAGAAGATTAGCTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-513s1c1
Sequence:CCGGCGTCTTGGATTCAGAACTAAACTCGAGTTTAGTTCTGAATCCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1753s1c1
Sequence:CCGGCGAGAGATTGGAAATCCAGTACTCGAGTACTGGATTTCCAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-909s1c1
Sequence:CCGGGAGAACCAAGTTCCAGGAAATCTCGAGATTTCCTGGAACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1803s1c1
Sequence:CCGGGCATTAGAGATCCAGCACATTCTCGAGAATGTGCTGGATCTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-625s1c1
Sequence:CCGGCTTCGCAACCAAATCTGTGAACTCGAGTTCACAGATTTGGTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152772
TCP11L2 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-886s1c1
Sequence:CCGGCAACGCCAGTTGGTGGAATATCTCGAGATATTCCACCAACTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1680s1c1
Sequence:CCGGGCTCTTCAATGAGGAAGCCATCTCGAGATGGCTTCCTCATTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1788s1c1
Sequence:CCGGCCACTTCCATTGATGGCATTACTCGAGTAATGCCATCAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1414s1c1
Sequence:CCGGGCTGAGATTCAAGCTAATCTTCTCGAGAAGATTAGCTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-513s1c1
Sequence:CCGGCGTCTTGGATTCAGAACTAAACTCGAGTTTAGTTCTGAATCCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1753s1c1
Sequence:CCGGCGAGAGATTGGAAATCCAGTACTCGAGTACTGGATTTCCAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-909s1c1
Sequence:CCGGGAGAACCAAGTTCCAGGAAATCTCGAGATTTCCTGGAACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1803s1c1
Sequence:CCGGGCATTAGAGATCCAGCACATTCTCGAGAATGTGCTGGATCTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-625s1c1
Sequence:CCGGCTTCGCAACCAAATCTGTGAACTCGAGTTCACAGATTTGGTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152772
TCP11L2 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-886s1c1
Sequence:CCGGCAACGCCAGTTGGTGGAATATCTCGAGATATTCCACCAACTGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1680s1c1
Sequence:CCGGGCTCTTCAATGAGGAAGCCATCTCGAGATGGCTTCCTCATTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1788s1c1
Sequence:CCGGCCACTTCCATTGATGGCATTACTCGAGTAATGCCATCAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-1414s1c1
Sequence:CCGGGCTGAGATTCAAGCTAATCTTCTCGAGAAGATTAGCTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152772.1-513s1c1
Sequence:CCGGCGTCTTGGATTCAGAACTAAACTCGAGTTTAGTTCTGAATCCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1753s1c1
Sequence:CCGGCGAGAGATTGGAAATCCAGTACTCGAGTACTGGATTTCCAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-909s1c1
Sequence:CCGGGAGAACCAAGTTCCAGGAAATCTCGAGATTTCCTGGAACTTGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152772.1-1803s1c1
Sequence:CCGGGCATTAGAGATCCAGCACATTCTCGAGAATGTGCTGGATCTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152772.1-625s1c1
Sequence:CCGGCTTCGCAACCAAATCTGTGAACTCGAGTTCACAGATTTGGTTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146008
VALIDATED
TCP11L2 MISSION shRNA Bacterial Glycerol Stock
t-complex 11, testis-specific-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-2066s1c1
Sequence:CCGGCCTGGAGTATATTGCACATTTCTCGAGAAATGTGCAATATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1099s1c1
Sequence:CCGGCCCTCTGTTGGTGCTTAATAACTCGAGTTATTAAGCACCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1645s1c1
Sequence:CCGGCCAGTATGCAAACATTGTGAACTCGAGTTCACAATGTTTGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1243s1c1
Sequence:CCGGCGTGGCCTTAATCACCAACAACTCGAGTTGTTGGTGATTAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-602s1c1
Sequence:CCGGGCCATCAAACTGTTTGAAGAACTCGAGTTCTTCAAACAGTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146008
VALIDATED
TCP11L2 MISSION shRNA shRNA Plasmid DNA
t-complex 11, testis-specific-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-2066s1c1
Sequence:CCGGCCTGGAGTATATTGCACATTTCTCGAGAAATGTGCAATATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1099s1c1
Sequence:CCGGCCCTCTGTTGGTGCTTAATAACTCGAGTTATTAAGCACCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1645s1c1
Sequence:CCGGCCAGTATGCAAACATTGTGAACTCGAGTTCACAATGTTTGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1243s1c1
Sequence:CCGGCGTGGCCTTAATCACCAACAACTCGAGTTGTTGGTGATTAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-602s1c1
Sequence:CCGGGCCATCAAACTGTTTGAAGAACTCGAGTTCTTCAAACAGTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146008
VALIDATED
TCP11L2 MISSION shRNA Lentiviral Transduction Particles
t-complex 11, testis-specific-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-2066s1c1
Sequence:CCGGCCTGGAGTATATTGCACATTTCTCGAGAAATGTGCAATATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1099s1c1
Sequence:CCGGCCCTCTGTTGGTGCTTAATAACTCGAGTTATTAAGCACCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1645s1c1
Sequence:CCGGCCAGTATGCAAACATTGTGAACTCGAGTTCACAATGTTTGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-1243s1c1
Sequence:CCGGCGTGGCCTTAATCACCAACAACTCGAGTTGTTGGTGATTAAGGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146008.1-602s1c1
Sequence:CCGGGCCATCAAACTGTTTGAAGAACTCGAGTTCTTCAAACAGTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks