EMAIL THIS PAGE TO A FRIEND

TCP1

t-complex 1

Synonyms: CCT-alpha CCT1 CCTa D6S230E TCP-1-alpha
UniProtKB ID: P17987, E1P5B2, Q15556, Q5TCM3
Gene ID:
Human(6950) Summary: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
Mouse(21454) t-complex protein 1
Rat(24818) t-complex 1
Thale Cress(3767658) transcription factor TCP1
Horse(100050689) t-complex 1
dog(484064) t-complex 1
chicken(421586) t-complex 1
Zebrafish(30477) t-complex polypeptide 1
cow(512043) t-complex 1
sheep(100135437) t-complex 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501026 Anti-TCP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA027337 Anti-TCP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 mouse, rat, human
immunohistochemistry, western blot pricing
HPA031082 Anti-TCP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
SAB5201743 Monoclonal Anti-Tcp1 Alpha - Alkaline Phosphatase antibody produced in rat clone 23c, purified immunoglobulin dog, mouse, hamster, rat, sheep, rabbit, bovine
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201761 Monoclonal Anti-Tcp1 Alpha - Alkaline Phosphatase antibody produced in rat clone 91a, purified immunoglobulin bovine, pig, Saccharomyces cerevisiae, mouse, rat, rabbit, Caenorhabditis elegans, guinea pig, hamster, Drosophila melanogaster, dog, human, monkey
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201744 Monoclonal Anti-Tcp1 Alpha - Apc antibody produced in rat clone 23c, purified immunoglobulin mouse, hamster, rabbit, rat, sheep, dog, bovine
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201762 Monoclonal Anti-Tcp1 Alpha - Apc antibody produced in rat clone 91a, purified immunoglobulin hamster, rabbit, dog, mouse, Saccharomyces cerevisiae, Caenorhabditis elegans, bovine, human, Drosophila melanogaster, pig, monkey, rat, guinea pig
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201735 Monoclonal Anti-Tcp1 Alpha - Atto 390 antibody produced in rat clone 23c, purified immunoglobulin dog, rabbit, bovine, sheep, hamster, mouse, rat
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201753 Monoclonal Anti-Tcp1 Alpha - Atto 390 antibody produced in rat clone 91a, purified immunoglobulin guinea pig, pig, Saccharomyces cerevisiae, dog, Drosophila melanogaster, monkey, mouse, rat, hamster, Caenorhabditis elegans, rabbit, bovine, human
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201736 Monoclonal Anti-Tcp1 Alpha - Atto 488 antibody produced in rat clone 23c, purified immunoglobulin rabbit, dog, rat, bovine, mouse, sheep, hamster
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201754 Monoclonal Anti-Tcp1 Alpha - Atto 488 antibody produced in rat clone 91a, purified immunoglobulin rat, human, dog, Drosophila melanogaster, guinea pig, hamster, Saccharomyces cerevisiae, pig, Caenorhabditis elegans, monkey, rabbit, bovine, mouse
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201737 Monoclonal Anti-Tcp1 Alpha - Atto 565 antibody produced in rat clone 23c, purified immunoglobulin sheep, hamster, rabbit, mouse, bovine, rat, dog
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201755 Monoclonal Anti-Tcp1 Alpha - Atto 565 antibody produced in rat clone 91a, purified immunoglobulin mouse, guinea pig, human, Drosophila melanogaster, bovine, dog, monkey, hamster, Caenorhabditis elegans, rat, rabbit, pig, Saccharomyces cerevisiae
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201738 Monoclonal Anti-Tcp1 Alpha - Atto 594 antibody produced in rat clone 23c, purified immunoglobulin mouse, rat, bovine, sheep, rabbit, dog, hamster
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201756 Monoclonal Anti-Tcp1 Alpha - Atto 594 antibody produced in rat clone 91a, purified immunoglobulin Caenorhabditis elegans, mouse, hamster, Saccharomyces cerevisiae, Drosophila melanogaster, monkey, rat, guinea pig, bovine, human, pig, rabbit, dog
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201739 Monoclonal Anti-Tcp1 Alpha - Atto 633 antibody produced in rat clone 23c, purified immunoglobulin mouse, rabbit, bovine, hamster, sheep, dog, rat
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201757 Monoclonal Anti-Tcp1 Alpha - Atto 633 antibody produced in rat clone 91a, purified immunoglobulin rat, pig, dog, mouse, rabbit, guinea pig, Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, hamster, bovine, monkey, human
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201740 Monoclonal Anti-Tcp1 Alpha - Atto 655 antibody produced in rat clone 23c, purified immunoglobulin mouse, rabbit, sheep, bovine, hamster, rat, dog
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201758 Monoclonal Anti-Tcp1 Alpha - Atto 655 antibody produced in rat clone 91a, purified immunoglobulin hamster, Caenorhabditis elegans, monkey, rabbit, pig, Drosophila melanogaster, guinea pig, dog, human, rat, bovine, Saccharomyces cerevisiae, mouse
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201741 Monoclonal Anti-Tcp1 Alpha - Atto 680 antibody produced in rat clone 23c, purified immunoglobulin sheep, hamster, mouse, rabbit, bovine, dog, rat
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201759 Monoclonal Anti-Tcp1 Alpha - Atto 680 antibody produced in rat clone 91a, purified immunoglobulin hamster, dog, human, rat, Caenorhabditis elegans, mouse, rabbit, monkey, guinea pig, Drosophila melanogaster, pig, bovine, Saccharomyces cerevisiae
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201742 Monoclonal Anti-Tcp1 Alpha - Atto 700 antibody produced in rat clone 23c, purified immunoglobulin dog, rabbit, hamster, rat, mouse, sheep, bovine
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201760 Monoclonal Anti-Tcp1 Alpha - Atto 700 antibody produced in rat clone 91a, purified immunoglobulin dog, rabbit, guinea pig, pig, Caenorhabditis elegans, Drosophila melanogaster, hamster, human, rat, monkey, mouse, bovine, Saccharomyces cerevisiae
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201745 Monoclonal Anti-Tcp1 Alpha - Biotin antibody produced in rat clone 23c, purified immunoglobulin bovine, mouse, rat, sheep, rabbit, hamster, dog
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201763 Monoclonal Anti-Tcp1 Alpha - Biotin antibody produced in rat clone 91a, purified immunoglobulin mouse, rabbit, Saccharomyces cerevisiae, guinea pig, hamster, dog, bovine, pig, monkey, rat, human, Caenorhabditis elegans, Drosophila melanogaster
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201746 Monoclonal Anti-Tcp1 Alpha - Fitc antibody produced in rat clone 23c, purified immunoglobulin rat, sheep, rabbit, dog, hamster, bovine, mouse
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201764 Monoclonal Anti-Tcp1 Alpha - Fitc antibody produced in rat clone 91a, purified immunoglobulin rat, mouse, pig, monkey, guinea pig, dog, human, bovine, Saccharomyces cerevisiae, rabbit, hamster, Caenorhabditis elegans, Drosophila melanogaster
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201747 Monoclonal Anti-Tcp1 Alpha - Hrp antibody produced in rat clone 23c, purified immunoglobulin dog, rabbit, rat, sheep, hamster, bovine, mouse
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201765 Monoclonal Anti-Tcp1 Alpha - Hrp antibody produced in rat clone 91a, purified immunoglobulin mouse, bovine, pig, Saccharomyces cerevisiae, rat, hamster, human, rabbit, guinea pig, dog, Caenorhabditis elegans, Drosophila melanogaster, monkey
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5201748 Monoclonal Anti-Tcp1 Alpha - Pe/Atto 594 antibody produced in rat clone 23c, purified immunoglobulin rabbit, dog, rat, sheep, hamster, mouse, bovine
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201766 Monoclonal Anti-Tcp1 Alpha - Pe/Atto 594 antibody produced in rat clone 91a, purified immunoglobulin mouse, rat, human, rabbit, dog, Saccharomyces cerevisiae, Drosophila melanogaster, monkey, bovine, pig, Caenorhabditis elegans, guinea pig, hamster
flow cytometry, immunoprecipitation, western blot pricing
SAB5201749 Monoclonal Anti-Tcp1 Alpha - Percp antibody produced in rat clone 23c, purified immunoglobulin mouse, sheep, rat, dog, bovine, hamster, rabbit
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201767 Monoclonal Anti-Tcp1 Alpha - Percp antibody produced in rat clone 91a, purified immunoglobulin pig, monkey, rabbit, dog, Drosophila melanogaster, hamster, bovine, Saccharomyces cerevisiae, mouse, rat, human, Caenorhabditis elegans, guinea pig
flow cytometry, immunoprecipitation, western blot pricing
SAB5201750 Monoclonal Anti-Tcp1 Alpha - Rpe antibody produced in rat clone 23c, purified immunoglobulin hamster, mouse, rat, rabbit, bovine, sheep, dog
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201768 Monoclonal Anti-Tcp1 Alpha - Rpe antibody produced in rat clone 91a, purified immunoglobulin guinea pig, mouse, hamster, bovine, Saccharomyces cerevisiae, monkey, rat, Caenorhabditis elegans, pig, Drosophila melanogaster, dog, human, rabbit
flow cytometry, immunoprecipitation, western blot pricing
SAB5201751 Monoclonal Anti-Tcp1 Alpha - Streptavidin antibody produced in rat clone 23c, purified immunoglobulin hamster, rat, sheep, mouse, bovine, rabbit, dog
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201769 Monoclonal Anti-Tcp1 Alpha - Streptavidin antibody produced in rat clone 91a, purified immunoglobulin mouse, human, Drosophila melanogaster, rat, guinea pig, dog, Caenorhabditis elegans, hamster, rabbit, bovine, pig, monkey, Saccharomyces cerevisiae
flow cytometry, immunoprecipitation, western blot pricing
WH0006950M1 Monoclonal Anti-TCP1 antibody produced in mouse clone 2B2-D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5201734 Monoclonal Anti-Tcp1-Alpha antibody produced in rat clone 23c, purified immunoglobulin dog, rat, bovine, mouse, rabbit, sheep, hamster
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB5201752 Monoclonal Anti-Tcp1-Alpha antibody produced in rat clone 91a, purified immunoglobulin dog, Saccharomyces cerevisiae, rat, guinea pig, hamster, human, monkey, mouse, bovine, Drosophila melanogaster, pig, Caenorhabditis elegans, rabbit
flow cytometry, immunohistochemistry, immunoprecipitation, western blot pricing
PLA0279 Rabbit anti-TCP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, marmoset, human, primate, chimpanzee, gibbon, rhesus monkey
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030752 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008897 Rosetta Predictions human pricing
NM_030752 Rosetta Predictions human pricing
NM_012670 Rosetta Predictions rat pricing
NM_013686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074994 predicted 654
2 SASI_Hs02_00305595 predicted 1861
3 SASI_Hs01_00074995 predicted 1656
4 SASI_Hs01_00074996 predicted 1721
5 SASI_Hs01_00074997 predicted 748
6 SASI_Hs01_00074998 predicted 1204
7 SASI_Hs01_00074999 predicted 1770
8 SASI_Hs01_00075000 predicted 1805
9 SASI_Hs01_00075001 predicted 1700
10 SASI_Hs01_00075002 predicted 763
11 SASI_Hs01_00075003 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022492 predicted 742
2 SASI_Hs02_00358266 predicted 1945
3 SASI_Hs01_00022493 predicted 1742
4 SASI_Hs01_00022494 predicted 1808
5 SASI_Hs01_00022495 predicted 841
6 SASI_Hs01_00022496 predicted 1290
7 SASI_Hs01_00022497 predicted 1862
8 SASI_Hs01_00022498 predicted 1883
9 SASI_Hs01_00022499 predicted 1795
10 SASI_Hs01_00022501 predicted 1571
11 SASI_Hs01_00022500 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035685 predicted 1379
2 SASI_Rn01_00035686 predicted 1207
3 SASI_Rn02_00259941 predicted 271
4 SASI_Rn01_00035687 predicted 1239
5 SASI_Rn01_00035688 predicted 221
6 SASI_Rn01_00035689 predicted 944
7 SASI_Rn01_00035690 predicted 1398
8 SASI_Rn01_00035691 predicted 1484
9 SASI_Rn01_00035692 predicted 734
10 SASI_Rn01_00035693 predicted 1426
11 SASI_Rn01_00035694 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108559 predicted 1409
2 SASI_Mm01_00108560 predicted 578
3 SASI_Mm01_00108561 predicted 1516
4 SASI_Mm02_00322566 predicted 971
5 SASI_Mm01_00108563 predicted 280
6 SASI_Mm01_00108564 predicted 1088
7 SASI_Mm02_00322567 predicted 241
8 SASI_Mm01_00108565 predicted 872
9 SASI_Mm02_00322568 predicted 1162
10 SASI_Mm01_00108566 predicted 1421
11 SASI_Mm01_00108562 predicted 928
12 SASI_Mm01_00108567 predicted 1161
13 SASI_Mm01_00108568 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030752
VALIDATED
TCP1 MISSION shRNA Bacterial Glycerol Stock
t-complex 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-308s21c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1559s21c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030752.2-2277s21c1
Sequence:CCGGCTCCTTCAATATTGACCTAACCTCGAGGTTAGGTCAATATTGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1404s21c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1345s1c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-94s1c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1190s1c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-627s1c1
Sequence:CCGGGAGAAGTCAAATGGAGAGTATCTCGAGATACTCTCCATTTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030752.1-1624s1c1
Sequence:CCGGCCAGAAATCCTTCGGATTAAACTCGAGTTTAATCCGAAGGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030752
VALIDATED
TCP1 MISSION shRNA shRNA Plasmid DNA
t-complex 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-308s21c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1559s21c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030752.2-2277s21c1
Sequence:CCGGCTCCTTCAATATTGACCTAACCTCGAGGTTAGGTCAATATTGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1404s21c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1345s1c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-94s1c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1190s1c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-627s1c1
Sequence:CCGGGAGAAGTCAAATGGAGAGTATCTCGAGATACTCTCCATTTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030752.1-1624s1c1
Sequence:CCGGCCAGAAATCCTTCGGATTAAACTCGAGTTTAATCCGAAGGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030752
VALIDATED
TCP1 MISSION shRNA Lentiviral Transduction Particles
t-complex 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-308s21c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1559s21c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030752.2-2277s21c1
Sequence:CCGGCTCCTTCAATATTGACCTAACCTCGAGGTTAGGTCAATATTGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030752.2-1404s21c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1345s1c1
Sequence:CCGGGCAAGATCACTTCTTGTTATTCTCGAGAATAACAAGAAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-94s1c1
Sequence:CCGGGCAGCTTCGATTGCCAATATTCTCGAGAATATTGGCAATCGAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-1190s1c1
Sequence:CCGGGCTCTTTACATGATGCACTTTCTCGAGAAAGTGCATCATGTAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_030752.1-627s1c1
Sequence:CCGGGAGAAGTCAAATGGAGAGTATCTCGAGATACTCTCCATTTGACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030752.1-1624s1c1
Sequence:CCGGCCAGAAATCCTTCGGATTAAACTCGAGTTTAATCCGAAGGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013686
VALIDATED
TCP1 MISSION shRNA Bacterial Glycerol Stock
t-complex 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1397s1c1
Sequence:CCGGCCTAATACACTGGCAGTGAATCTCGAGATTCACTGCCAGTGTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013686.1-617s1c1
Sequence:CCGGCGCTATCCAATCAATTCTGTTCTCGAGAACAGAATTGATTGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-395s1c1
Sequence:CCGGACATCAGTTATTAGTGGCTATCTCGAGATAGCCACTAATAACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1220s1c1
Sequence:CCGGCGCTCTTTACATGATGCTCTTCTCGAGAAGAGCATCATGTAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-821s1c1
Sequence:CCGGCCTGAGAAATTGGACCAAATTCTCGAGAATTTGGTCCAATTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013686
VALIDATED
TCP1 MISSION shRNA shRNA Plasmid DNA
t-complex 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1397s1c1
Sequence:CCGGCCTAATACACTGGCAGTGAATCTCGAGATTCACTGCCAGTGTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013686.1-617s1c1
Sequence:CCGGCGCTATCCAATCAATTCTGTTCTCGAGAACAGAATTGATTGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-395s1c1
Sequence:CCGGACATCAGTTATTAGTGGCTATCTCGAGATAGCCACTAATAACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1220s1c1
Sequence:CCGGCGCTCTTTACATGATGCTCTTCTCGAGAAGAGCATCATGTAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-821s1c1
Sequence:CCGGCCTGAGAAATTGGACCAAATTCTCGAGAATTTGGTCCAATTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013686
VALIDATED
TCP1 MISSION shRNA Lentiviral Transduction Particles
t-complex 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1397s1c1
Sequence:CCGGCCTAATACACTGGCAGTGAATCTCGAGATTCACTGCCAGTGTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013686.1-617s1c1
Sequence:CCGGCGCTATCCAATCAATTCTGTTCTCGAGAACAGAATTGATTGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-395s1c1
Sequence:CCGGACATCAGTTATTAGTGGCTATCTCGAGATAGCCACTAATAACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-1220s1c1
Sequence:CCGGCGCTCTTTACATGATGCTCTTCTCGAGAAGAGCATCATGTAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013686.1-821s1c1
Sequence:CCGGCCTGAGAAATTGGACCAAATTCTCGAGAATTTGGTCCAATTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks