EMAIL THIS PAGE TO A FRIEND

TCTA

T-cell leukemia translocation altered

UniProtKB ID: P57738, B2R4I4, Q6I9U4, Q9BSB0
Gene ID:
Mouse(102791) T cell leukemia translocation altered gene
Rat(306587) T-cell leukemia translocation altered
cow(616169) T-cell leukemia translocation altered gene
sheep(101104532) T-cell leukemia translocation altered
domestic guinea pig(100729392) T-cell leukemia translocation altered
naked mole-rat(101711062) T-cell leukemia translocation altered
Zebrafish(436858) T-cell leukemia translocation altered gene
dog(608826) T-cell leukemia translocation altered
domestic cat(101084522) T-cell leukemia translocation altered
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007342 Anti-TCTA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104845 Anti-TCTA antibody produced in rabbit affinity isolated antibody human, mouse, rat, horse, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022171 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119291 MISSION® esiRNA esiRNA human TCTA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022171 Rosetta Predictions human pricing
NM_001014005 Rosetta Predictions rat pricing
NM_133986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013391 predicted 460
2 SASI_Hs01_00013392 predicted 403
3 SASI_Hs02_00355606 predicted 473
4 SASI_Hs01_00013393 predicted 311
5 SASI_Hs01_00013394 predicted 734
6 SASI_Hs01_00013395 predicted 518
7 SASI_Hs01_00013396 predicted 469
8 SASI_Hs01_00013397 predicted 1561
9 SASI_Hs01_00013398 predicted 1426
10 SASI_Hs01_00013399 predicted 2057
11 SASI_Hs01_00013400 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053108 predicted 823
2 SASI_Rn01_00053109 predicted 829
3 SASI_Rn01_00053111 predicted 336
4 SASI_Rn01_00053112 predicted 835
5 SASI_Rn01_00053113 predicted 385
6 SASI_Rn01_00053114 predicted 385
7 SASI_Rn02_00201375 predicted 650
8 SASI_Rn01_00053115 predicted 389
9 SASI_Rn01_00053116 predicted 792
10 SASI_Rn01_00053117 predicted 402
11 SASI_Rn01_00053110 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101966 predicted 605
2 SASI_Mm01_00101967 predicted 823
3 SASI_Mm01_00101968 predicted 837
4 SASI_Mm01_00101969 predicted 207
5 SASI_Mm01_00101970 predicted 297
6 SASI_Mm01_00101971 predicted 296
7 SASI_Mm01_00101972 predicted 567
8 SASI_Mm01_00101973 predicted 360
9 SASI_Mm01_00101974 predicted 295
10 SASI_Mm01_00101975 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133986
VALIDATED
TCTA MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia translocation altered
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-201s21c1
Sequence:CCGGACACAGTGACCGGGTTGTATCCTCGAGGATACAACCCGGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-369s21c1
Sequence:CCGGGAGAATAAGGGAAGGCAGCAGCTCGAGCTGCTGCCTTCCCTTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-419s21c1
Sequence:CCGGCCGCTGGCTCCTATGCTATTTCTCGAGAAATAGCATAGGAGCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-330s21c1
Sequence:CCGGCATGGGAGATAGCAGCAAATGCTCGAGCATTTGCTGCTATCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-290s21c1
Sequence:CCGGCAGAATGGATCCACACCTGATCTCGAGATCAGGTGTGGATCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-247s21c1
Sequence:CCGGTCCTGCAGCTATGGGTGTGTTCTCGAGAACACACCCATAGCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-114s21c1
Sequence:CCGGACATGCGAGTGACTCTCTTCACTCGAGTGAAGAGAGTCACTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-199s1c1
Sequence:CCGGGAACACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-341s1c1
Sequence:CCGGGCAGCAAATGAAGCTCTCAAACTCGAGTTTGAGAGCTTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-312s1c1
Sequence:CCGGGCTCCACACATTTCTCTTCATCTCGAGATGAAGAGAAATGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133986.1-566s1c1
Sequence:CCGGGCAGGTGAAGTTTGTCTCTTACTCGAGTAAGAGACAAACTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-81s1c1
Sequence:CCGGGCAGCGACTTTCTGCGGGAGTCTCGAGACTCCCGCAGAAAGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133986
VALIDATED
TCTA MISSION shRNA shRNA Plasmid DNA
T-cell leukemia translocation altered
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-201s21c1
Sequence:CCGGACACAGTGACCGGGTTGTATCCTCGAGGATACAACCCGGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-369s21c1
Sequence:CCGGGAGAATAAGGGAAGGCAGCAGCTCGAGCTGCTGCCTTCCCTTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-419s21c1
Sequence:CCGGCCGCTGGCTCCTATGCTATTTCTCGAGAAATAGCATAGGAGCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-330s21c1
Sequence:CCGGCATGGGAGATAGCAGCAAATGCTCGAGCATTTGCTGCTATCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-290s21c1
Sequence:CCGGCAGAATGGATCCACACCTGATCTCGAGATCAGGTGTGGATCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-247s21c1
Sequence:CCGGTCCTGCAGCTATGGGTGTGTTCTCGAGAACACACCCATAGCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-114s21c1
Sequence:CCGGACATGCGAGTGACTCTCTTCACTCGAGTGAAGAGAGTCACTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-199s1c1
Sequence:CCGGGAACACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-341s1c1
Sequence:CCGGGCAGCAAATGAAGCTCTCAAACTCGAGTTTGAGAGCTTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-312s1c1
Sequence:CCGGGCTCCACACATTTCTCTTCATCTCGAGATGAAGAGAAATGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133986.1-566s1c1
Sequence:CCGGGCAGGTGAAGTTTGTCTCTTACTCGAGTAAGAGACAAACTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-81s1c1
Sequence:CCGGGCAGCGACTTTCTGCGGGAGTCTCGAGACTCCCGCAGAAAGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133986
VALIDATED
TCTA MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia translocation altered
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-201s21c1
Sequence:CCGGACACAGTGACCGGGTTGTATCCTCGAGGATACAACCCGGTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-369s21c1
Sequence:CCGGGAGAATAAGGGAAGGCAGCAGCTCGAGCTGCTGCCTTCCCTTATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-419s21c1
Sequence:CCGGCCGCTGGCTCCTATGCTATTTCTCGAGAAATAGCATAGGAGCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133986.1-330s21c1
Sequence:CCGGCATGGGAGATAGCAGCAAATGCTCGAGCATTTGCTGCTATCTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-290s21c1
Sequence:CCGGCAGAATGGATCCACACCTGATCTCGAGATCAGGTGTGGATCCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-247s21c1
Sequence:CCGGTCCTGCAGCTATGGGTGTGTTCTCGAGAACACACCCATAGCTGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133986.1-114s21c1
Sequence:CCGGACATGCGAGTGACTCTCTTCACTCGAGTGAAGAGAGTCACTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-199s1c1
Sequence:CCGGGAACACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-341s1c1
Sequence:CCGGGCAGCAAATGAAGCTCTCAAACTCGAGTTTGAGAGCTTCATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-312s1c1
Sequence:CCGGGCTCCACACATTTCTCTTCATCTCGAGATGAAGAGAAATGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133986.1-566s1c1
Sequence:CCGGGCAGGTGAAGTTTGTCTCTTACTCGAGTAAGAGACAAACTTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133986.1-81s1c1
Sequence:CCGGGCAGCGACTTTCTGCGGGAGTCTCGAGACTCCCGCAGAAAGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022171
VALIDATED
TCTA MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia translocation altered
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1740s1c1
Sequence:CCGGCATCTTCTCTACCTTCAAGAACTCGAGTTCTTGAAGGTAGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-404s1c1
Sequence:CCGGGAATACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1091s1c1
Sequence:CCGGGCAGGAGATTTGCTTGAACCTCTCGAGAGGTTCAAGCAAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-350s1c1
Sequence:CCGGGCTGTGGTTGGTGTTAAGTCTCTCGAGAGACTTAACACCAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1937s1c1
Sequence:CCGGCCTACTTCCTTCCTGTTGGATCTCGAGATCCAACAGGAAGGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022171.1-477s1c1
Sequence:CCGGCATTTCCCTTCGTGGGAAATGCTCGAGCATTTCCCACGAAGGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022171
VALIDATED
TCTA MISSION shRNA shRNA Plasmid DNA
T-cell leukemia translocation altered
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1740s1c1
Sequence:CCGGCATCTTCTCTACCTTCAAGAACTCGAGTTCTTGAAGGTAGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-404s1c1
Sequence:CCGGGAATACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1091s1c1
Sequence:CCGGGCAGGAGATTTGCTTGAACCTCTCGAGAGGTTCAAGCAAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-350s1c1
Sequence:CCGGGCTGTGGTTGGTGTTAAGTCTCTCGAGAGACTTAACACCAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1937s1c1
Sequence:CCGGCCTACTTCCTTCCTGTTGGATCTCGAGATCCAACAGGAAGGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022171.1-477s1c1
Sequence:CCGGCATTTCCCTTCGTGGGAAATGCTCGAGCATTTCCCACGAAGGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022171
VALIDATED
TCTA MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia translocation altered
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144042    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1740s1c1
Sequence:CCGGCATCTTCTCTACCTTCAAGAACTCGAGTTCTTGAAGGTAGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-404s1c1
Sequence:CCGGGAATACAGTGACCGGGTTGTACTCGAGTACAACCCGGTCACTGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1091s1c1
Sequence:CCGGGCAGGAGATTTGCTTGAACCTCTCGAGAGGTTCAAGCAAATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-350s1c1
Sequence:CCGGGCTGTGGTTGGTGTTAAGTCTCTCGAGAGACTTAACACCAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022171.1-1937s1c1
Sequence:CCGGCCTACTTCCTTCCTGTTGGATCTCGAGATCCAACAGGAAGGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022171.1-477s1c1
Sequence:CCGGCATTTCCCTTCGTGGGAAATGCTCGAGCATTTCCCACGAAGGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks