EMAIL THIS PAGE TO A FRIEND

TCTE1

t-complex-associated-testis-expressed 1

Synonyms: D6S46
UniProtKB ID: Q5JU00, B4DX59, Q8IYS6
Gene ID:
Mouse(21645) t-complex-associated testis expressed 1
Rat(316242) t-complex-associated testis expressed 1
Zebrafish(100331698) t-complex-associated-testis-expressed 1
chicken(421437) t-complex-associated-testis-expressed 1
Horse(100067816) t-complex-associated-testis-expressed 1
domestic cat(101096316) t-complex-associated-testis-expressed 1
dog(609664) t-complex-associated-testis-expressed 1
naked mole-rat(101699440) t-complex-associated-testis-expressed 1
domestic guinea pig(100735482) t-complex-associated-testis-expressed 1
cow(523600) t-complex-associated-testis-expressed 1
sheep(101118566) t-complex-associated-testis-expressed 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102399 Anti-TCTE1 antibody produced in rabbit affinity isolated antibody rat, rabbit, canine, bovine, guinea pig, mouse, horse, human
western blot pricing
HPA031739 Anti-TCTE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182539 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094931 MISSION® esiRNA esiRNA targeting mouse Tcte1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182539 Rosetta Predictions human pricing
NM_001108206 Rosetta Predictions rat pricing
NM_013688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091055 predicted 222
2 SASI_Hs01_00091056 predicted 936
3 SASI_Hs02_00370646 predicted 1191
4 SASI_Hs01_00091057 predicted 1232
5 SASI_Hs01_00091058 predicted 995
6 SASI_Hs01_00091060 predicted 605
7 SASI_Hs01_00091062 predicted 616
8 SASI_Hs01_00091063 predicted 569
9 SASI_Hs02_00370647 predicted 225
10 SASI_Hs01_00091064 predicted 867
11 SASI_Hs01_00091059 predicted 202
12 SASI_Hs01_00091061 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236364 predicted 1535
2 SASI_Rn02_00236365 predicted 1555
3 SASI_Rn02_00236366 predicted 409
4 SASI_Rn02_00236367 predicted 799
5 SASI_Rn02_00236368 predicted 282
6 SASI_Rn02_00236369 predicted 309
7 SASI_Rn02_00236370 predicted 883
8 SASI_Rn02_00236371 predicted 900
9 SASI_Rn02_00236372 predicted 939
10 SASI_Rn02_00236373 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115725 predicted 973
2 SASI_Mm01_00115728 predicted 1093
3 SASI_Mm01_00115729 predicted 1104
4 SASI_Mm01_00115730 predicted 449
5 SASI_Mm02_00322575 predicted 1704
6 SASI_Mm02_00322576 predicted 1784
7 SASI_Mm01_00115726 predicted 1702
8 SASI_Mm01_00115732 predicted 1165
9 SASI_Mm01_00115733 predicted 776
10 SASI_Mm02_00322577 predicted 499
11 SASI_Mm01_00115727 predicted 284
12 SASI_Mm01_00115731 predicted 387
13 SASI_Mm01_00115734 predicted 1640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182539
TCTE1 MISSION shRNA Bacterial Glycerol Stock
t-complex-associated-testis-expressed 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-1476s1c1
Sequence:CCGGGAATTTGACTTGCGCCTGTCACTCGAGTGACAGGCGCAAGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-884s1c1
Sequence:CCGGCGGCATGAATTTCGAGTGGAACTCGAGTTCCACTCGAAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-615s1c1
Sequence:CCGGCTGCTAAAGCACTTTATCCCACTCGAGTGGGATAAAGTGCTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-497s1c1
Sequence:CCGGCCTGATAGACAGTGAGAACTACTCGAGTAGTTCTCACTGTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182539.1-609s1c1
Sequence:CCGGGAGAACCTGCTAAAGCACTTTCTCGAGAAAGTGCTTTAGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-400s21c1
Sequence:CCGGCTCTGCATTCAGCACATTATCCTCGAGGATAATGTGCTGAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-1535s21c1
Sequence:CCGGAGGAAAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182539
TCTE1 MISSION shRNA shRNA Plasmid DNA
t-complex-associated-testis-expressed 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-1476s1c1
Sequence:CCGGGAATTTGACTTGCGCCTGTCACTCGAGTGACAGGCGCAAGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-884s1c1
Sequence:CCGGCGGCATGAATTTCGAGTGGAACTCGAGTTCCACTCGAAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-615s1c1
Sequence:CCGGCTGCTAAAGCACTTTATCCCACTCGAGTGGGATAAAGTGCTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-497s1c1
Sequence:CCGGCCTGATAGACAGTGAGAACTACTCGAGTAGTTCTCACTGTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182539.1-609s1c1
Sequence:CCGGGAGAACCTGCTAAAGCACTTTCTCGAGAAAGTGCTTTAGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-400s21c1
Sequence:CCGGCTCTGCATTCAGCACATTATCCTCGAGGATAATGTGCTGAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-1535s21c1
Sequence:CCGGAGGAAAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182539
TCTE1 MISSION shRNA Lentiviral Transduction Particles
t-complex-associated-testis-expressed 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-1476s1c1
Sequence:CCGGGAATTTGACTTGCGCCTGTCACTCGAGTGACAGGCGCAAGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-884s1c1
Sequence:CCGGCGGCATGAATTTCGAGTGGAACTCGAGTTCCACTCGAAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-615s1c1
Sequence:CCGGCTGCTAAAGCACTTTATCCCACTCGAGTGGGATAAAGTGCTTTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182539.1-497s1c1
Sequence:CCGGCCTGATAGACAGTGAGAACTACTCGAGTAGTTCTCACTGTCTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182539.1-609s1c1
Sequence:CCGGGAGAACCTGCTAAAGCACTTTCTCGAGAAAGTGCTTTAGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-400s21c1
Sequence:CCGGCTCTGCATTCAGCACATTATCCTCGAGGATAATGTGCTGAATGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182539.3-1535s21c1
Sequence:CCGGAGGAAAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013688
TCTE1 MISSION shRNA Bacterial Glycerol Stock
t-complex-associated-testis-expressed 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1501s1c1
Sequence:CCGGCCTCACCCACTAACAACTGTACTCGAGTACAGTTGTTAGTGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1496s1c1
Sequence:CCGGCTTCTCCTCACCCACTAACAACTCGAGTTGTTAGTGGGTGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013688.1-2432s1c1
Sequence:CCGGGCTGACTAATTCAAACTCTTACTCGAGTAAGAGTTTGAATTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-601s21c1
Sequence:CCGGTTGATTGACGATGAGAATTACCTCGAGGTAATTCTCATCGTCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013688.2-1774s21c1
Sequence:CCGGCCGGCAACCACACCTTCATTTCTCGAGAAATGAAGGTGTGGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1610s21c1
Sequence:CCGGAGGAGAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1502s21c1
Sequence:CCGGACCTATCCTGCAACCACATTGCTCGAGCAATGTGGTTGCAGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1096s21c1
Sequence:CCGGAGTAAGGTGGACGACGATAAGCTCGAGCTTATCGTCGTCCACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013688
TCTE1 MISSION shRNA shRNA Plasmid DNA
t-complex-associated-testis-expressed 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1501s1c1
Sequence:CCGGCCTCACCCACTAACAACTGTACTCGAGTACAGTTGTTAGTGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1496s1c1
Sequence:CCGGCTTCTCCTCACCCACTAACAACTCGAGTTGTTAGTGGGTGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013688.1-2432s1c1
Sequence:CCGGGCTGACTAATTCAAACTCTTACTCGAGTAAGAGTTTGAATTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-601s21c1
Sequence:CCGGTTGATTGACGATGAGAATTACCTCGAGGTAATTCTCATCGTCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013688.2-1774s21c1
Sequence:CCGGCCGGCAACCACACCTTCATTTCTCGAGAAATGAAGGTGTGGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1610s21c1
Sequence:CCGGAGGAGAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1502s21c1
Sequence:CCGGACCTATCCTGCAACCACATTGCTCGAGCAATGTGGTTGCAGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1096s21c1
Sequence:CCGGAGTAAGGTGGACGACGATAAGCTCGAGCTTATCGTCGTCCACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013688
TCTE1 MISSION shRNA Lentiviral Transduction Particles
t-complex-associated-testis-expressed 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1501s1c1
Sequence:CCGGCCTCACCCACTAACAACTGTACTCGAGTACAGTTGTTAGTGGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013688.1-1496s1c1
Sequence:CCGGCTTCTCCTCACCCACTAACAACTCGAGTTGTTAGTGGGTGAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013688.1-2432s1c1
Sequence:CCGGGCTGACTAATTCAAACTCTTACTCGAGTAAGAGTTTGAATTAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-601s21c1
Sequence:CCGGTTGATTGACGATGAGAATTACCTCGAGGTAATTCTCATCGTCAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013688.2-1774s21c1
Sequence:CCGGCCGGCAACCACACCTTCATTTCTCGAGAAATGAAGGTGTGGTTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1610s21c1
Sequence:CCGGAGGAGAGCGAGTACCTCATTGCTCGAGCAATGAGGTACTCGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1502s21c1
Sequence:CCGGACCTATCCTGCAACCACATTGCTCGAGCAATGTGGTTGCAGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013688.2-1096s21c1
Sequence:CCGGAGTAAGGTGGACGACGATAAGCTCGAGCTTATCGTCGTCCACCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks