EMAIL THIS PAGE TO A FRIEND

TCTE3

t-complex-associated-testis-expressed 3

Synonyms: TCTEX1D3
UniProtKB ID: Q8IZS6
Gene ID:
Mouse(21647) t-complex-associated testis expressed 3
Rat(365153) t-complex-associated testis expressed 3
cow(789619) t-complex-associated-testis-expressed 3
sheep(101115716) t-complex-associated-testis-expressed 3
domestic guinea pig(100734143) t-complex-associated-testis-expressed 3
naked mole-rat(101698474) t-complex-associated-testis-expressed 3
chicken(421555) t-complex-associated-testis-expressed 3
dog(475038) t-complex-associated-testis-expressed 3
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174910 Rosetta Predictions human pricing
XM_001055805 Rosetta Predictions rat pricing
XM_344846 Rosetta Predictions rat pricing
NM_011560 Rosetta Predictions mouse pricing
NM_198104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083890 predicted 500
2 SASI_Hs01_00083891 predicted 489
3 SASI_Hs01_00083893 predicted 227
4 SASI_Hs02_00368817 predicted 230
5 SASI_Hs01_00083894 predicted 481
6 SASI_Hs01_00083895 predicted 400
7 SASI_Hs01_00083896 predicted 384
8 SASI_Hs01_00083897 predicted 510
9 SASI_Hs01_00083899 predicted 354
10 SASI_Hs02_00368818 predicted 459
11 SASI_Hs01_00083892 predicted 374
12 SASI_Hs01_00083898 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281085 predicted 394
2 SASI_Rn02_00281086 predicted 303
3 SASI_Rn02_00281087 predicted 430
4 SASI_Rn02_00281088 predicted 388
5 SASI_Rn02_00281089 predicted 272
6 SASI_Rn02_00281090 predicted 422
7 SASI_Rn02_00281091 predicted 415
8 SASI_Rn02_00281092 predicted 340
9 SASI_Rn02_00281093 predicted 223
10 SASI_Rn02_00281094 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397656 predicted 396
2 SASI_Rn02_00397657 predicted 307
3 SASI_Rn02_00397658 predicted 432
4 SASI_Rn02_00397659 predicted 383
5 SASI_Rn02_00397660 predicted 277
6 SASI_Rn02_00397661 predicted 426
7 SASI_Rn02_00397662 predicted 412
8 SASI_Rn02_00397663 predicted 331
9 SASI_Rn02_00397664 predicted 220
10 SASI_Rn02_00397665 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029110 predicted 511
2 SASI_Mm01_00029112 predicted 387
3 SASI_Mm01_00029117 predicted 528
4 SASI_Mm01_00029118 predicted 427
5 SASI_Mm01_00029119 predicted 420
6 SASI_Mm02_00320910 predicted 410
7 SASI_Mm02_00320911 predicted 467
8 SASI_Mm02_00320912 predicted 342
9 SASI_Mm02_00320913 predicted 412
10 SASI_Mm02_00320914 predicted 505
11 SASI_Mm01_00029111 predicted 552
12 SASI_Mm01_00029113 predicted 555
13 SASI_Mm01_00029114 predicted 566
14 SASI_Mm01_00029115 predicted 565
15 SASI_Mm01_00029116 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104515 predicted 382
2 SASI_Mm01_00104516 predicted 383
3 SASI_Mm01_00104517 predicted 381
4 SASI_Mm01_00104518 predicted 410
5 SASI_Mm01_00104519 predicted 339
6 SASI_Mm01_00104520 predicted 341
7 SASI_Mm01_00104522 predicted 402
8 SASI_Mm01_00104523 predicted 337
9 SASI_Mm02_00350828 predicted 378
10 SASI_Mm02_00350829 predicted 387
11 SASI_Mm01_00104514 predicted 409
12 SASI_Mm01_00104521 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011560
VALIDATED
TCTE3 MISSION shRNA Bacterial Glycerol Stock
t-complex-associated-testis-expressed 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-556s21c1
Sequence:CCGGGAATTTGCATACCATCGTTATCTCGAGATAACGATGGTATGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-298s1c1
Sequence:CCGGGCACATTTGGTAGAAACTAAACTCGAGTTTAGTTTCTACCAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-485s1c1
Sequence:CCGGCAATAAATATTGCCAGCAGATCTCGAGATCTGCTGGCAATATTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-190s1c1
Sequence:CCGGCCTCCGTTTGATGACTCAATTCTCGAGAATTGAGTCATCAAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-93s1c1
Sequence:CCGGGAGAGAAAGGAAGCCTAGCATCTCGAGATGCTAGGCTTCCTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-372s1c1
Sequence:CCGGCCCTCATTTGTCACTTGAATTCTCGAGAATTCAAGTGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-474s21c1
Sequence:CCGGCAGTCTTAAAGATGTCAAATACTCGAGTATTTGACATCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011560
VALIDATED
TCTE3 MISSION shRNA shRNA Plasmid DNA
t-complex-associated-testis-expressed 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-556s21c1
Sequence:CCGGGAATTTGCATACCATCGTTATCTCGAGATAACGATGGTATGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-298s1c1
Sequence:CCGGGCACATTTGGTAGAAACTAAACTCGAGTTTAGTTTCTACCAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-485s1c1
Sequence:CCGGCAATAAATATTGCCAGCAGATCTCGAGATCTGCTGGCAATATTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-190s1c1
Sequence:CCGGCCTCCGTTTGATGACTCAATTCTCGAGAATTGAGTCATCAAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-93s1c1
Sequence:CCGGGAGAGAAAGGAAGCCTAGCATCTCGAGATGCTAGGCTTCCTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-372s1c1
Sequence:CCGGCCCTCATTTGTCACTTGAATTCTCGAGAATTCAAGTGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-474s21c1
Sequence:CCGGCAGTCTTAAAGATGTCAAATACTCGAGTATTTGACATCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011560
VALIDATED
TCTE3 MISSION shRNA Lentiviral Transduction Particles
t-complex-associated-testis-expressed 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-556s21c1
Sequence:CCGGGAATTTGCATACCATCGTTATCTCGAGATAACGATGGTATGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-298s1c1
Sequence:CCGGGCACATTTGGTAGAAACTAAACTCGAGTTTAGTTTCTACCAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-485s1c1
Sequence:CCGGCAATAAATATTGCCAGCAGATCTCGAGATCTGCTGGCAATATTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-190s1c1
Sequence:CCGGCCTCCGTTTGATGACTCAATTCTCGAGAATTGAGTCATCAAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011560.2-93s1c1
Sequence:CCGGGAGAGAAAGGAAGCCTAGCATCTCGAGATGCTAGGCTTCCTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011560.2-372s1c1
Sequence:CCGGCCCTCATTTGTCACTTGAATTCTCGAGAATTCAAGTGACAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011560.3-474s21c1
Sequence:CCGGCAGTCTTAAAGATGTCAAATACTCGAGTATTTGACATCTTTAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174910
TCTE3 MISSION shRNA Bacterial Glycerol Stock
t-complex-associated-testis-expressed 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-499s1c1
Sequence:CCGGGAATTTGGGTACCACCGTTATCTCGAGATAACGGTGGTACCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-221s1c1
Sequence:CCGGGAGAAAGACTGAGAGAGTCAACTCGAGTTGACTCTCTCAGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-369s1c1
Sequence:CCGGCCAAGCTCATTCAGTAGAAACCTCGAGGTTTCTACTGAATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-385s1c1
Sequence:CCGGGAAACTAAAGTCCAGCAGATACTCGAGTATCTGCTGGACTTTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-510s1c1
Sequence:CCGGCCACCGTTATAAGTTCATTATCTCGAGATAATGAACTTATAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-223s1c1
Sequence:CCGGGAAAGACTGAGAGAGTCAATTCTCGAGAATTGACTCTCTCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-229s1c1
Sequence:CCGGCTGAGAGAGTCAATTCACAATCTCGAGATTGTGAATTGACTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-557s1c1
Sequence:CCGGGCCAAGCAATAAATATTGCCACTCGAGTGGCAATATTTATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-399s1c1
Sequence:CCGGGCAGATACTAACAGAAAGTCTCTCGAGAGACTTTCTGTTAGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174910
TCTE3 MISSION shRNA shRNA Plasmid DNA
t-complex-associated-testis-expressed 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-499s1c1
Sequence:CCGGGAATTTGGGTACCACCGTTATCTCGAGATAACGGTGGTACCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-221s1c1
Sequence:CCGGGAGAAAGACTGAGAGAGTCAACTCGAGTTGACTCTCTCAGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-369s1c1
Sequence:CCGGCCAAGCTCATTCAGTAGAAACCTCGAGGTTTCTACTGAATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-385s1c1
Sequence:CCGGGAAACTAAAGTCCAGCAGATACTCGAGTATCTGCTGGACTTTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-510s1c1
Sequence:CCGGCCACCGTTATAAGTTCATTATCTCGAGATAATGAACTTATAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-223s1c1
Sequence:CCGGGAAAGACTGAGAGAGTCAATTCTCGAGAATTGACTCTCTCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-229s1c1
Sequence:CCGGCTGAGAGAGTCAATTCACAATCTCGAGATTGTGAATTGACTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-557s1c1
Sequence:CCGGGCCAAGCAATAAATATTGCCACTCGAGTGGCAATATTTATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-399s1c1
Sequence:CCGGGCAGATACTAACAGAAAGTCTCTCGAGAGACTTTCTGTTAGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174910
TCTE3 MISSION shRNA Lentiviral Transduction Particles
t-complex-associated-testis-expressed 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-499s1c1
Sequence:CCGGGAATTTGGGTACCACCGTTATCTCGAGATAACGGTGGTACCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-221s1c1
Sequence:CCGGGAGAAAGACTGAGAGAGTCAACTCGAGTTGACTCTCTCAGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-369s1c1
Sequence:CCGGCCAAGCTCATTCAGTAGAAACCTCGAGGTTTCTACTGAATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-385s1c1
Sequence:CCGGGAAACTAAAGTCCAGCAGATACTCGAGTATCTGCTGGACTTTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-510s1c1
Sequence:CCGGCCACCGTTATAAGTTCATTATCTCGAGATAATGAACTTATAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174910.1-223s1c1
Sequence:CCGGGAAAGACTGAGAGAGTCAATTCTCGAGAATTGACTCTCTCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-229s1c1
Sequence:CCGGCTGAGAGAGTCAATTCACAATCTCGAGATTGTGAATTGACTCTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-557s1c1
Sequence:CCGGGCCAAGCAATAAATATTGCCACTCGAGTGGCAATATTTATTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174910.1-399s1c1
Sequence:CCGGGCAGATACTAACAGAAAGTCTCTCGAGAGACTTTCTGTTAGTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks