EMAIL THIS PAGE TO A FRIEND

TCTEX1D1

Tctex1 domain containing 1

Synonyms: RP11-266I14.2
UniProtKB ID: Q8N7M0, Q06YR9, Q5VYE1
Gene ID:
Mouse(67344) Tctex1 domain containing 1
Rat(362553) Tctex1 domain containing 1
cow(522474) Tctex1 domain containing 1
sheep(101113023) Tctex1 domain containing 1
naked mole-rat(101702487) Tctex1 domain containing 1
domestic guinea pig(100724432) Tctex1 domain containing 1
Zebrafish(447884) Tctex1 domain containing 1
chicken(424701) Tctex1 domain containing 1
dog(609768) Tctex1 domain containing 1
domestic cat(101086327) Tctex1 domain containing 1
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152665 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152665 Rosetta Predictions human pricing
NM_026100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218499 predicted 477
2 SASI_Hs01_00218501 predicted 621
3 SASI_Hs01_00218502 predicted 752
4 SASI_Hs01_00218503 predicted 399
5 SASI_Hs02_00366556 predicted 447
6 SASI_Hs01_00218504 predicted 281
7 SASI_Hs01_00218505 predicted 674
8 SASI_Hs01_00218506 predicted 905
9 SASI_Hs01_00218507 predicted 484
10 SASI_Hs01_00218508 predicted 550
11 SASI_Hs01_00218500 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058424 predicted 518
2 SASI_Mm01_00058425 predicted 675
3 SASI_Mm01_00058426 predicted 340
4 SASI_Mm01_00058427 predicted 300
5 SASI_Mm01_00058428 predicted 737
6 SASI_Mm01_00058429 predicted 612
7 SASI_Mm01_00058430 predicted 758
8 SASI_Mm01_00058432 predicted 582
9 SASI_Mm02_00329675 predicted 506
10 SASI_Mm01_00058433 predicted 622
11 SASI_Mm01_00058431 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152665
TCTEX1D1 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-388s1c1
Sequence:CCGGGATGTAGTAACCAGCTATCTACTCGAGTAGATAGCTGGTTACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-1152s1c1
Sequence:CCGGGCAGCATTCATTAAGTGCAATCTCGAGATTGCACTTAATGAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-843s1c1
Sequence:CCGGGCCACAGAAAGAATCTTGTTTCTCGAGAAACAAGATTCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-489s1c1
Sequence:CCGGCTTGATGATTCCACGGTATAACTCGAGTTATACCGTGGAATCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-401s1c1
Sequence:CCGGGCTATCTACAAGTAGAAGAATCTCGAGATTCTTCTACTTGTAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-394s1c1
Sequence:CCGGGTAACCAGCTATCTACAAGTACTCGAGTACTTGTAGATAGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-844s1c1
Sequence:CCGGCCACAGAAAGAATCTTGTTTACTCGAGTAAACAAGATTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-478s1c1
Sequence:CCGGCAGGTCAAGGACTTGATGATTCTCGAGAATCATCAAGTCCTTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-160s1c1
Sequence:CCGGGCAGCTCATTCATGGAAGAAACTCGAGTTTCTTCCATGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-226s1c1
Sequence:CCGGGAAATTCATGGGCGCATCAAACTCGAGTTTGATGCGCCCATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-535s1c1
Sequence:CCGGCAACTGAACAGGCAGAGCATACTCGAGTATGCTCTGCCTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-289s1c1
Sequence:CCGGCGTGATGATATCTCTCGCCTTCTCGAGAAGGCGAGAGATATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152665.1-871s1c1
Sequence:CCGGGCAGGAACTTGATCTTGGTTTCTCGAGAAACCAAGATCAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-305s1c1
Sequence:CCGGGCCTTACAGTTCAGATGGAAACTCGAGTTTCCATCTGAACTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152665
TCTEX1D1 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-388s1c1
Sequence:CCGGGATGTAGTAACCAGCTATCTACTCGAGTAGATAGCTGGTTACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-1152s1c1
Sequence:CCGGGCAGCATTCATTAAGTGCAATCTCGAGATTGCACTTAATGAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-843s1c1
Sequence:CCGGGCCACAGAAAGAATCTTGTTTCTCGAGAAACAAGATTCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-489s1c1
Sequence:CCGGCTTGATGATTCCACGGTATAACTCGAGTTATACCGTGGAATCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-401s1c1
Sequence:CCGGGCTATCTACAAGTAGAAGAATCTCGAGATTCTTCTACTTGTAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-394s1c1
Sequence:CCGGGTAACCAGCTATCTACAAGTACTCGAGTACTTGTAGATAGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-844s1c1
Sequence:CCGGCCACAGAAAGAATCTTGTTTACTCGAGTAAACAAGATTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-478s1c1
Sequence:CCGGCAGGTCAAGGACTTGATGATTCTCGAGAATCATCAAGTCCTTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-160s1c1
Sequence:CCGGGCAGCTCATTCATGGAAGAAACTCGAGTTTCTTCCATGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-226s1c1
Sequence:CCGGGAAATTCATGGGCGCATCAAACTCGAGTTTGATGCGCCCATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-535s1c1
Sequence:CCGGCAACTGAACAGGCAGAGCATACTCGAGTATGCTCTGCCTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-289s1c1
Sequence:CCGGCGTGATGATATCTCTCGCCTTCTCGAGAAGGCGAGAGATATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152665.1-871s1c1
Sequence:CCGGGCAGGAACTTGATCTTGGTTTCTCGAGAAACCAAGATCAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-305s1c1
Sequence:CCGGGCCTTACAGTTCAGATGGAAACTCGAGTTTCCATCTGAACTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152665
TCTEX1D1 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-388s1c1
Sequence:CCGGGATGTAGTAACCAGCTATCTACTCGAGTAGATAGCTGGTTACTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-1152s1c1
Sequence:CCGGGCAGCATTCATTAAGTGCAATCTCGAGATTGCACTTAATGAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-843s1c1
Sequence:CCGGGCCACAGAAAGAATCTTGTTTCTCGAGAAACAAGATTCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-489s1c1
Sequence:CCGGCTTGATGATTCCACGGTATAACTCGAGTTATACCGTGGAATCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-401s1c1
Sequence:CCGGGCTATCTACAAGTAGAAGAATCTCGAGATTCTTCTACTTGTAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-394s1c1
Sequence:CCGGGTAACCAGCTATCTACAAGTACTCGAGTACTTGTAGATAGCTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152665.1-844s1c1
Sequence:CCGGCCACAGAAAGAATCTTGTTTACTCGAGTAAACAAGATTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-478s1c1
Sequence:CCGGCAGGTCAAGGACTTGATGATTCTCGAGAATCATCAAGTCCTTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-160s1c1
Sequence:CCGGGCAGCTCATTCATGGAAGAAACTCGAGTTTCTTCCATGAATGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-226s1c1
Sequence:CCGGGAAATTCATGGGCGCATCAAACTCGAGTTTGATGCGCCCATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-535s1c1
Sequence:CCGGCAACTGAACAGGCAGAGCATACTCGAGTATGCTCTGCCTGTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152665.1-289s1c1
Sequence:CCGGCGTGATGATATCTCTCGCCTTCTCGAGAAGGCGAGAGATATCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152665.1-871s1c1
Sequence:CCGGGCAGGAACTTGATCTTGGTTTCTCGAGAAACCAAGATCAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152665.1-305s1c1
Sequence:CCGGGCCTTACAGTTCAGATGGAAACTCGAGTTTCCATCTGAACTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026100
TCTEX1D1 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-501s1c1
Sequence:CCGGGATGTACTAACTACCTACCTACTCGAGTAGGTAGGTAGTTAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026100.1-785s1c1
Sequence:CCGGGAAAGTGGTCCTTGTGTGTTACTCGAGTAACACACAAGGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-754s1c1
Sequence:CCGGCAAATGTCTATGCAGTTTACTCTCGAGAGTAAACTGCATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-473s1c1
Sequence:CCGGCGTGGCCACTGTCAATCATATCTCGAGATATGATTGACAGTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-651s21c1
Sequence:CCGGGATGACCAGAGCATAGTTATTCTCGAGAATAACTATGCTCTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-973s21c1
Sequence:CCGGGTCAGTGCCATTCACATAAATCTCGAGATTTATGTGAATGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1186s21c1
Sequence:CCGGAGGCCTTAGTACTGCATATAACTCGAGTTATATGCAGTACTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-678s21c1
Sequence:CCGGAGATGCCTCTGGAATCCTAAACTCGAGTTTAGGATTCCAGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-599s21c1
Sequence:CCGGATTAGTGATTCCGAGATATAACTCGAGTTATATCTCGGAATCACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1103s21c1
Sequence:CCGGGCAACATACTCTGGATATATACTCGAGTATATATCCAGAGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026100
TCTEX1D1 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-501s1c1
Sequence:CCGGGATGTACTAACTACCTACCTACTCGAGTAGGTAGGTAGTTAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026100.1-785s1c1
Sequence:CCGGGAAAGTGGTCCTTGTGTGTTACTCGAGTAACACACAAGGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-754s1c1
Sequence:CCGGCAAATGTCTATGCAGTTTACTCTCGAGAGTAAACTGCATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-473s1c1
Sequence:CCGGCGTGGCCACTGTCAATCATATCTCGAGATATGATTGACAGTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-651s21c1
Sequence:CCGGGATGACCAGAGCATAGTTATTCTCGAGAATAACTATGCTCTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-973s21c1
Sequence:CCGGGTCAGTGCCATTCACATAAATCTCGAGATTTATGTGAATGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1186s21c1
Sequence:CCGGAGGCCTTAGTACTGCATATAACTCGAGTTATATGCAGTACTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-678s21c1
Sequence:CCGGAGATGCCTCTGGAATCCTAAACTCGAGTTTAGGATTCCAGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-599s21c1
Sequence:CCGGATTAGTGATTCCGAGATATAACTCGAGTTATATCTCGGAATCACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1103s21c1
Sequence:CCGGGCAACATACTCTGGATATATACTCGAGTATATATCCAGAGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026100
TCTEX1D1 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-501s1c1
Sequence:CCGGGATGTACTAACTACCTACCTACTCGAGTAGGTAGGTAGTTAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026100.1-785s1c1
Sequence:CCGGGAAAGTGGTCCTTGTGTGTTACTCGAGTAACACACAAGGACCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-754s1c1
Sequence:CCGGCAAATGTCTATGCAGTTTACTCTCGAGAGTAAACTGCATAGACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026100.1-473s1c1
Sequence:CCGGCGTGGCCACTGTCAATCATATCTCGAGATATGATTGACAGTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-651s21c1
Sequence:CCGGGATGACCAGAGCATAGTTATTCTCGAGAATAACTATGCTCTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-973s21c1
Sequence:CCGGGTCAGTGCCATTCACATAAATCTCGAGATTTATGTGAATGGCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1186s21c1
Sequence:CCGGAGGCCTTAGTACTGCATATAACTCGAGTTATATGCAGTACTAAGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-678s21c1
Sequence:CCGGAGATGCCTCTGGAATCCTAAACTCGAGTTTAGGATTCCAGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026100.3-599s21c1
Sequence:CCGGATTAGTGATTCCGAGATATAACTCGAGTTATATCTCGGAATCACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026100.3-1103s21c1
Sequence:CCGGGCAACATACTCTGGATATATACTCGAGTATATATCCAGAGTATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks