EMAIL THIS PAGE TO A FRIEND

TCTEX1D2

Tctex1 domain containing 2

UniProtKB ID: Q8WW35, A6NCN5
Gene ID:
Mouse(66061) Tctex1 domain containing 2
Rat(498095) Tctex1 domain containing 2
Zebrafish(553323) Tctex1 domain containing 2
chicken(424914) Tctex1 domain containing 2
domestic cat(101099578) Tctex1 domain containing 2
dog(478601) Tctex1 domain containing 2
domestic guinea pig(100723481) Tctex1 domain containing 2
naked mole-rat(101705938) Tctex1 domain containing 2
cow(504554) Tctex1 domain containing 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152773 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064091 MISSION® esiRNA esiRNA targeting mouse Tctex1d2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152773 Rosetta Predictions human pricing
NM_001109054 Rosetta Predictions rat pricing
NM_025329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104243 predicted 200
2 SASI_Hs01_00104245 predicted 422
3 SASI_Hs01_00104246 predicted 276
4 SASI_Hs01_00104247 predicted 365
5 SASI_Hs01_00104248 predicted 395
6 SASI_Hs01_00104249 predicted 267
7 SASI_Hs02_00366714 predicted 236
8 SASI_Hs01_00104250 predicted 282
9 SASI_Hs01_00104251 predicted 257
10 SASI_Hs01_00104252 predicted 257
11 SASI_Hs01_00104244 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244670 predicted 210
2 SASI_Rn02_00244671 predicted 227
3 SASI_Rn02_00244672 predicted 263
4 SASI_Rn02_00244673 predicted 281
5 SASI_Rn02_00244674 predicted 212
6 SASI_Rn02_00244675 predicted 258
7 SASI_Rn02_00244676 predicted 279
8 SASI_Rn02_00244677 predicted 202
9 SASI_Rn02_00244678 predicted 213
10 SASI_Rn02_00244679 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139057 predicted 301
2 SASI_Mm01_00139058 predicted 383
3 SASI_Mm02_00327978 predicted 356
4 SASI_Mm02_00327979 predicted 269
5 SASI_Mm01_00139062 predicted 265
6 SASI_Mm02_00327980 predicted 332
7 SASI_Mm02_00327981 predicted 361
8 SASI_Mm01_00139066 predicted 241
9 SASI_Mm02_00327982 predicted 338
10 SASI_Mm02_00327983 predicted 353
11 SASI_Mm01_00139059 predicted 456
12 SASI_Mm01_00139060 predicted 512
13 SASI_Mm01_00139061 predicted 283
14 SASI_Mm01_00139063 predicted 422
15 SASI_Mm01_00139064 predicted 521
16 SASI_Mm01_00139065 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025329
VALIDATED
TCTEX1D2 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-505s21c1
Sequence:CCGGTCTGTGTGGTGGCAGCATTTGCTCGAGCAAATGCTGCCACCACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-326s21c1
Sequence:CCGGACGTCTATCAGAAATGATTAACTCGAGTTAATCATTTCTGATAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-229s21c1
Sequence:CCGGTTAGACCCTCTGTGGTTAAAGCTCGAGCTTTAACCACAGAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-504s1c1
Sequence:CCGGCGTTGGGAAGTGTGACTTCAACTCGAGTTGAAGTCACACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-479s1c1
Sequence:CCGGCATTTGGGTGTTTCTACTATTCTCGAGAATAGTAGAAACACCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-155s1c1
Sequence:CCGGCCTACATTCTGAGGCCCATTTCTCGAGAAATGGGCCTCAGAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-421s1c1
Sequence:CCGGACGGACAACTACACTCACGATCTCGAGATCGTGAGTGTAGTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-319s1c1
Sequence:CCGGGAATTGGGATATGACCGGTATCTCGAGATACCGGTCATATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025329
VALIDATED
TCTEX1D2 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-505s21c1
Sequence:CCGGTCTGTGTGGTGGCAGCATTTGCTCGAGCAAATGCTGCCACCACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-326s21c1
Sequence:CCGGACGTCTATCAGAAATGATTAACTCGAGTTAATCATTTCTGATAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-229s21c1
Sequence:CCGGTTAGACCCTCTGTGGTTAAAGCTCGAGCTTTAACCACAGAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-504s1c1
Sequence:CCGGCGTTGGGAAGTGTGACTTCAACTCGAGTTGAAGTCACACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-479s1c1
Sequence:CCGGCATTTGGGTGTTTCTACTATTCTCGAGAATAGTAGAAACACCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-155s1c1
Sequence:CCGGCCTACATTCTGAGGCCCATTTCTCGAGAAATGGGCCTCAGAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-421s1c1
Sequence:CCGGACGGACAACTACACTCACGATCTCGAGATCGTGAGTGTAGTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-319s1c1
Sequence:CCGGGAATTGGGATATGACCGGTATCTCGAGATACCGGTCATATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025329
VALIDATED
TCTEX1D2 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-505s21c1
Sequence:CCGGTCTGTGTGGTGGCAGCATTTGCTCGAGCAAATGCTGCCACCACACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-326s21c1
Sequence:CCGGACGTCTATCAGAAATGATTAACTCGAGTTAATCATTTCTGATAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025329.3-229s21c1
Sequence:CCGGTTAGACCCTCTGTGGTTAAAGCTCGAGCTTTAACCACAGAGGGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-504s1c1
Sequence:CCGGCGTTGGGAAGTGTGACTTCAACTCGAGTTGAAGTCACACTTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-479s1c1
Sequence:CCGGCATTTGGGTGTTTCTACTATTCTCGAGAATAGTAGAAACACCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-155s1c1
Sequence:CCGGCCTACATTCTGAGGCCCATTTCTCGAGAAATGGGCCTCAGAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-421s1c1
Sequence:CCGGACGGACAACTACACTCACGATCTCGAGATCGTGAGTGTAGTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025329.1-319s1c1
Sequence:CCGGGAATTGGGATATGACCGGTATCTCGAGATACCGGTCATATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152773
VALIDATED
TCTEX1D2 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-544s21c1
Sequence:CCGGATTTGGCTGTTTCTACTACTGCTCGAGCAGTAGTAGAAACAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-218s21c1
Sequence:CCGGACCTATATTCTGCGGCCTGTTCTCGAGAACAGGCCGCAGAATATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-528s21c1
Sequence:CCGGTCTGCGTTGTAGCAGCATTTGCTCGAGCAAATGCTGCTACAACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-192s1c1
Sequence:CCGGGAGCCCGAGAACACCTATATTCTCGAGAATATAGGTGTTCTCGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-402s1c1
Sequence:CCGGCAAGTAGTGATTGGAGAACAACTCGAGTTGTTCTCCAATCACTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-244s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-465s1c1
Sequence:CCGGGCTGACACTGACAACTATACTCTCGAGAGTATAGTTGTCAGTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-462s1c1
Sequence:CCGGGATGCTGACACTGACAACTATCTCGAGATAGTTGTCAGTGTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152773
VALIDATED
TCTEX1D2 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-544s21c1
Sequence:CCGGATTTGGCTGTTTCTACTACTGCTCGAGCAGTAGTAGAAACAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-218s21c1
Sequence:CCGGACCTATATTCTGCGGCCTGTTCTCGAGAACAGGCCGCAGAATATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-528s21c1
Sequence:CCGGTCTGCGTTGTAGCAGCATTTGCTCGAGCAAATGCTGCTACAACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-192s1c1
Sequence:CCGGGAGCCCGAGAACACCTATATTCTCGAGAATATAGGTGTTCTCGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-402s1c1
Sequence:CCGGCAAGTAGTGATTGGAGAACAACTCGAGTTGTTCTCCAATCACTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-244s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-465s1c1
Sequence:CCGGGCTGACACTGACAACTATACTCTCGAGAGTATAGTTGTCAGTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-462s1c1
Sequence:CCGGGATGCTGACACTGACAACTATCTCGAGATAGTTGTCAGTGTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152773
VALIDATED
TCTEX1D2 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-544s21c1
Sequence:CCGGATTTGGCTGTTTCTACTACTGCTCGAGCAGTAGTAGAAACAGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-218s21c1
Sequence:CCGGACCTATATTCTGCGGCCTGTTCTCGAGAACAGGCCGCAGAATATAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152773.3-528s21c1
Sequence:CCGGTCTGCGTTGTAGCAGCATTTGCTCGAGCAAATGCTGCTACAACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-192s1c1
Sequence:CCGGGAGCCCGAGAACACCTATATTCTCGAGAATATAGGTGTTCTCGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152773.2-402s1c1
Sequence:CCGGCAAGTAGTGATTGGAGAACAACTCGAGTTGTTCTCCAATCACTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-244s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-465s1c1
Sequence:CCGGGCTGACACTGACAACTATACTCTCGAGAGTATAGTTGTCAGTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152773.2-462s1c1
Sequence:CCGGGATGCTGACACTGACAACTATCTCGAGATAGTTGTCAGTGTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks