EMAIL THIS PAGE TO A FRIEND

TCTEX1D4

Tctex1 domain containing 4

UniProtKB ID: Q5JR98
Gene ID:
Mouse(242646) Tctex1 domain containing 4
Rat(313527) Tctex1 domain containing 4
cow(516323) Tctex1 domain containing 4
naked mole-rat(101701989) Tctex1 domain containing 4
domestic guinea pig(100726339) Tctex1 domain containing 4
chicken(101666124) Tctex1 domain containing 4
chicken(101747461) Tctex1 domain containing 4
domestic cat(101100903) Tctex1 domain containing 4
dog(482520) Tctex1 domain containing 4
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087941 MISSION® esiRNA esiRNA targeting mouse Tctex1d4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013632 Rosetta Predictions human pricing
XM_001071721 Rosetta Predictions rat pricing
XM_233427 Rosetta Predictions rat pricing
NM_175030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232277 predicted 552
2 SASI_Hs01_00232279 predicted 809
3 SASI_Hs02_00306404 predicted 909
4 SASI_Hs01_00232280 predicted 1005
5 SASI_Hs01_00232281 predicted 597
6 SASI_Hs01_00232282 predicted 815
7 SASI_Hs02_00306405 predicted 555
8 SASI_Hs01_00232283 predicted 940
9 SASI_Hs01_00232284 predicted 978
10 SASI_Hs01_00232285 predicted 997
11 SASI_Hs01_00232278 predicted 598
12 SASI_Hs01_00232286 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336187 predicted 1014
2 SASI_Rn02_00336188 predicted 729
3 SASI_Rn02_00336189 predicted 877
4 SASI_Rn02_00336190 predicted 496
5 SASI_Rn02_00336191 predicted 636
6 SASI_Rn02_00336192 predicted 275
7 SASI_Rn02_00336193 predicted 1030
8 SASI_Rn02_00336194 predicted 421
9 SASI_Rn02_00336195 predicted 293
10 SASI_Rn02_00336196 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387752 predicted 280
2 SASI_Rn02_00387753 predicted 282
3 SASI_Rn02_00387754 predicted 247
4 SASI_Rn02_00387755 predicted 246
5 SASI_Rn02_00387756 predicted 241
6 SASI_Rn02_00387757 predicted 1017
7 SASI_Rn02_00387758 predicted 723
8 SASI_Rn02_00387759 predicted 875
9 SASI_Rn02_00387760 predicted 491
10 SASI_Rn02_00387761 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054936 predicted 265
2 SASI_Mm01_00054937 predicted 631
3 SASI_Mm01_00054938 predicted 271
4 SASI_Mm01_00054940 predicted 284
5 SASI_Mm01_00054941 predicted 638
6 SASI_Mm01_00054942 predicted 663
7 SASI_Mm01_00054943 predicted 529
8 SASI_Mm01_00054944 predicted 478
9 SASI_Mm01_00054945 predicted 539
10 SASI_Mm02_00345636 predicted 725
11 SASI_Mm01_00054939 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175030
TCTEX1D4 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-484s1c1
Sequence:CCGGCCTCTAGGTTCACGAGTTAGTCTCGAGACTAACTCGTGAACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-676s1c1
Sequence:CCGGCAGGCACTATGTGAACAGATACTCGAGTATCTGTTCACATAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-265s1c1
Sequence:CCGGCAGGAAGAGGAGACTACCAAACTCGAGTTTGGTAGTCTCCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-336s21c1
Sequence:CCGGATTGATGAGACCCGACCTATACTCGAGTATAGGTCGGGTCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-280s21c1
Sequence:CCGGCCAAAGACCTGGCTCTGAAATCTCGAGATTTCAGAGCCAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-540s21c1
Sequence:CCGGGCACCCTCATACCGCTTAGAACTCGAGTTCTAAGCGGTATGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-482s21c1
Sequence:CCGGCCCTCTAGGTTCACGAGTTAGCTCGAGCTAACTCGTGAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-665s21c1
Sequence:CCGGGAAACTGGTGCAGGCACTATGCTCGAGCATAGTGCCTGCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175030
TCTEX1D4 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-484s1c1
Sequence:CCGGCCTCTAGGTTCACGAGTTAGTCTCGAGACTAACTCGTGAACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-676s1c1
Sequence:CCGGCAGGCACTATGTGAACAGATACTCGAGTATCTGTTCACATAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-265s1c1
Sequence:CCGGCAGGAAGAGGAGACTACCAAACTCGAGTTTGGTAGTCTCCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-336s21c1
Sequence:CCGGATTGATGAGACCCGACCTATACTCGAGTATAGGTCGGGTCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-280s21c1
Sequence:CCGGCCAAAGACCTGGCTCTGAAATCTCGAGATTTCAGAGCCAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-540s21c1
Sequence:CCGGGCACCCTCATACCGCTTAGAACTCGAGTTCTAAGCGGTATGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-482s21c1
Sequence:CCGGCCCTCTAGGTTCACGAGTTAGCTCGAGCTAACTCGTGAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-665s21c1
Sequence:CCGGGAAACTGGTGCAGGCACTATGCTCGAGCATAGTGCCTGCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175030
TCTEX1D4 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-484s1c1
Sequence:CCGGCCTCTAGGTTCACGAGTTAGTCTCGAGACTAACTCGTGAACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-676s1c1
Sequence:CCGGCAGGCACTATGTGAACAGATACTCGAGTATCTGTTCACATAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175030.1-265s1c1
Sequence:CCGGCAGGAAGAGGAGACTACCAAACTCGAGTTTGGTAGTCTCCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-336s21c1
Sequence:CCGGATTGATGAGACCCGACCTATACTCGAGTATAGGTCGGGTCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-280s21c1
Sequence:CCGGCCAAAGACCTGGCTCTGAAATCTCGAGATTTCAGAGCCAGGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-540s21c1
Sequence:CCGGGCACCCTCATACCGCTTAGAACTCGAGTTCTAAGCGGTATGAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-482s21c1
Sequence:CCGGCCCTCTAGGTTCACGAGTTAGCTCGAGCTAACTCGTGAACCTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175030.2-665s21c1
Sequence:CCGGGAAACTGGTGCAGGCACTATGCTCGAGCATAGTGCCTGCACCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013632
TCTEX1D4 MISSION shRNA Bacterial Glycerol Stock
Tctex1 domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1006s21c1
Sequence:CCGGCACGCTACAAGCTGGTATGCACTCGAGTGCATACCAGCTTGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-600s21c1
Sequence:CCGGTGCCTGCCCAGCATTGATGAGCTCGAGCTCATCAATGCTGGGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-541s21c1
Sequence:CCGGAGGAGGAGGAGAATGCCAAAGCTCGAGCTTTGGCATTCTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1108s21c1
Sequence:CCGGCCTCGGTCTCCTACACCAACACTCGAGTGTTGGTGTAGGAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-772s21c1
Sequence:CCGGGCTCAAGGGTCAGCTTCTCAGCTCGAGCTGAGAAGCTGACCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013632
TCTEX1D4 MISSION shRNA shRNA Plasmid DNA
Tctex1 domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1006s21c1
Sequence:CCGGCACGCTACAAGCTGGTATGCACTCGAGTGCATACCAGCTTGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-600s21c1
Sequence:CCGGTGCCTGCCCAGCATTGATGAGCTCGAGCTCATCAATGCTGGGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-541s21c1
Sequence:CCGGAGGAGGAGGAGAATGCCAAAGCTCGAGCTTTGGCATTCTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1108s21c1
Sequence:CCGGCCTCGGTCTCCTACACCAACACTCGAGTGTTGGTGTAGGAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-772s21c1
Sequence:CCGGGCTCAAGGGTCAGCTTCTCAGCTCGAGCTGAGAAGCTGACCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013632
TCTEX1D4 MISSION shRNA Lentiviral Transduction Particles
Tctex1 domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1006s21c1
Sequence:CCGGCACGCTACAAGCTGGTATGCACTCGAGTGCATACCAGCTTGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-600s21c1
Sequence:CCGGTGCCTGCCCAGCATTGATGAGCTCGAGCTCATCAATGCTGGGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-541s21c1
Sequence:CCGGAGGAGGAGGAGAATGCCAAAGCTCGAGCTTTGGCATTCTCCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-1108s21c1
Sequence:CCGGCCTCGGTCTCCTACACCAACACTCGAGTGTTGGTGTAGGAGACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013632.2-772s21c1
Sequence:CCGGGCTCAAGGGTCAGCTTCTCAGCTCGAGCTGAGAAGCTGACCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks