EMAIL THIS PAGE TO A FRIEND

TCTN1

tectonic family member 1

Synonyms: JBTS13 TECT1
Gene ID:
Human(79600) Summary: This gene encodes a member of the tectonic family of secreted and transmembrane proteins. The orthologous gene in mouse is required for formation of most ventral cell types. It functions downstream of smoothened and rab23 to modulate hedgehog signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(654470) tectonic family member 1
Rat(304486) tectonic family member 1
Zebrafish(100007222) tectonic family member 1
chicken(416870) tectonic family member 1
dog(100686623) tectonic family member 1
Horse(100058201) tectonic family member 1
domestic cat(101100509) tectonic family member 1
cow(510513) tectonic family member 1
sheep(101106035) tectonic family member 1
domestic guinea pig(100718554) tectonic family member 1
naked mole-rat(101714825) tectonic family member 1
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082537 Rosetta Predictions human pricing
NM_001082538 Rosetta Predictions human pricing
NM_024549 Rosetta Predictions human pricing
XM_222188 Rosetta Predictions rat pricing
XR_009299 Rosetta Predictions rat pricing
NM_001039153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316672 predicted 1296
2 SASI_Hs02_00316673 predicted 319
3 SASI_Hs02_00316674 predicted 1322
4 SASI_Hs02_00316675 predicted 474
5 SASI_Hs02_00316676 predicted 1315
6 SASI_Hs02_00316677 predicted 401
7 SASI_Hs02_00316678 predicted 330
8 SASI_Hs02_00316679 predicted 580
9 SASI_Hs02_00316680 predicted 536
10 SASI_Hs02_00316681 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316682 predicted 1296
2 SASI_Hs02_00316683 predicted 323
3 SASI_Hs02_00316684 predicted 1321
4 SASI_Hs02_00316685 predicted 476
5 SASI_Hs02_00316686 predicted 1318
6 SASI_Hs02_00316687 predicted 395
7 SASI_Hs02_00316688 predicted 334
8 SASI_Hs02_00316689 predicted 579
9 SASI_Hs02_00316690 predicted 535
10 SASI_Hs02_00316691 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053410 predicted 1257
2 SASI_Hs02_00356852 predicted 317
3 SASI_Hs02_00356853 predicted 1285
4 SASI_Hs01_00053412 predicted 476
5 SASI_Hs01_00053415 predicted 1280
6 SASI_Hs02_00356854 predicted 398
7 SASI_Hs02_00356855 predicted 329
8 SASI_Hs02_00356856 predicted 583
9 SASI_Hs02_00356857 predicted 533
10 SASI_Hs02_00356858 predicted 307
11 SASI_Hs01_00053408 predicted 1313
12 SASI_Hs01_00053409 predicted 1294
13 SASI_Hs01_00053411 predicted 507
14 SASI_Hs01_00053413 predicted 483
15 SASI_Hs01_00053414 predicted 1557
16 SASI_Hs01_00053416 predicted 1524
17 SASI_Hs01_00053417 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133163 predicted 1327
2 SASI_Rn01_00133164 predicted 1345
3 SASI_Rn01_00133165 predicted 515
4 SASI_Rn01_00133166 predicted 688
5 SASI_Rn01_00133167 predicted 786
6 SASI_Rn01_00133168 predicted 1093
7 SASI_Rn01_00133169 predicted 973
8 SASI_Rn01_00133170 predicted 987
9 SASI_Rn01_00133171 predicted 231
10 SASI_Rn01_00133172 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151986 predicted 376
2 SASI_Rn02_00419330 predicted 418
3 SASI_Rn02_00419331 predicted 385
4 SASI_Rn02_00419332 predicted 407
5 SASI_Rn02_00419333 predicted 265
6 SASI_Rn02_00419334 predicted 443
7 SASI_Rn02_00419335 predicted 366
8 SASI_Rn02_00419336 predicted 264
9 SASI_Rn02_00419337 predicted 266
10 SASI_Rn02_00419338 predicted 256
11 SASI_Rn01_00151987 predicted 878
12 SASI_Rn01_00151988 predicted 985
13 SASI_Rn01_00151989 predicted 1217
14 SASI_Rn01_00151990 predicted 1232
15 SASI_Rn01_00151991 predicted 1112
16 SASI_Rn01_00151992 predicted 836
17 SASI_Rn01_00151993 predicted 1400
18 SASI_Rn01_00151994 predicted 889
19 SASI_Rn01_00151995 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093664 predicted 473
2 SASI_Mm02_00289869 predicted 1302
3 SASI_Mm02_00289870 predicted 925
4 SASI_Mm02_00289871 predicted 972
5 SASI_Mm02_00289872 predicted 924
6 SASI_Mm02_00289873 predicted 1334
7 SASI_Mm02_00289874 predicted 1200
8 SASI_Mm02_00289875 predicted 569
9 SASI_Mm02_00289876 predicted 961
10 SASI_Mm02_00289877 predicted 979
11 SASI_Mm01_00093662 predicted 274
12 SASI_Mm01_00093663 predicted 597
13 SASI_Mm01_00093665 predicted 798
14 SASI_Mm01_00093666 predicted 783
15 SASI_Mm01_00093667 predicted 831
16 SASI_Mm01_00093668 predicted 480
17 SASI_Mm01_00093669 predicted 812
18 SASI_Mm01_00093670 predicted 303
19 SASI_Mm01_00093671 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024549
VALIDATED
TCTN1 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-752s21c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024549.4-1835s21c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-514s21c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-689s21c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-959s1c1
Sequence:CCGGCTTTGCGTGAATGTTGTTCTTCTCGAGAAGAACAACATTCACGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1741s1c1
Sequence:CCGGCTTTAACTTCTTCTTCCCGTTCTCGAGAACGGGAAGAAGAAGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1776s1c1
Sequence:CCGGCAGATGCATCAGTTCCTTAATCTCGAGATTAAGGAACTGATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1773s1c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1630s1c1
Sequence:CCGGCTCAGGAAATGAAAGGACGATCTCGAGATCGTCCTTTCATTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1468s1c1
Sequence:CCGGCCACTTCATCACCCAGTCATTCTCGAGAATGACTGGGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-452s1c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-690s1c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1648s1c1
Sequence:CCGGGATTCTTATTTCCACTGCGGTCTCGAGACCGCAGTGGAAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-444s1c1
Sequence:CCGGCAAACCCACCTCAAAGAGTATCTCGAGATACTCTTTGAGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1774s1c1
Sequence:CCGGCTCAGATGCATCAGTTCCTTACTCGAGTAAGGAACTGATGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1769s1c1
Sequence:CCGGCAATGCTCAGATGCATCAGTTCTCGAGAACTGATGCATCTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-627s1c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-850s1c1
Sequence:CCGGCCCTATCACTGTTCAGTCCATCTCGAGATGGACTGAACAGTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024549
VALIDATED
TCTN1 MISSION shRNA shRNA Plasmid DNA
tectonic family member 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-752s21c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024549.4-1835s21c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-514s21c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-689s21c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-959s1c1
Sequence:CCGGCTTTGCGTGAATGTTGTTCTTCTCGAGAAGAACAACATTCACGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1741s1c1
Sequence:CCGGCTTTAACTTCTTCTTCCCGTTCTCGAGAACGGGAAGAAGAAGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1776s1c1
Sequence:CCGGCAGATGCATCAGTTCCTTAATCTCGAGATTAAGGAACTGATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1773s1c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1630s1c1
Sequence:CCGGCTCAGGAAATGAAAGGACGATCTCGAGATCGTCCTTTCATTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1468s1c1
Sequence:CCGGCCACTTCATCACCCAGTCATTCTCGAGAATGACTGGGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-452s1c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-690s1c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1648s1c1
Sequence:CCGGGATTCTTATTTCCACTGCGGTCTCGAGACCGCAGTGGAAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-444s1c1
Sequence:CCGGCAAACCCACCTCAAAGAGTATCTCGAGATACTCTTTGAGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1774s1c1
Sequence:CCGGCTCAGATGCATCAGTTCCTTACTCGAGTAAGGAACTGATGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1769s1c1
Sequence:CCGGCAATGCTCAGATGCATCAGTTCTCGAGAACTGATGCATCTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-627s1c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-850s1c1
Sequence:CCGGCCCTATCACTGTTCAGTCCATCTCGAGATGGACTGAACAGTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024549
VALIDATED
TCTN1 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-752s21c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024549.4-1835s21c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-514s21c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024549.4-689s21c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-959s1c1
Sequence:CCGGCTTTGCGTGAATGTTGTTCTTCTCGAGAAGAACAACATTCACGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1741s1c1
Sequence:CCGGCTTTAACTTCTTCTTCCCGTTCTCGAGAACGGGAAGAAGAAGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1776s1c1
Sequence:CCGGCAGATGCATCAGTTCCTTAATCTCGAGATTAAGGAACTGATGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1773s1c1
Sequence:CCGGGCTCAGATGCATCAGTTCCTTCTCGAGAAGGAACTGATGCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1630s1c1
Sequence:CCGGCTCAGGAAATGAAAGGACGATCTCGAGATCGTCCTTTCATTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024549.3-1468s1c1
Sequence:CCGGCCACTTCATCACCCAGTCATTCTCGAGAATGACTGGGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-452s1c1
Sequence:CCGGCCTCAAAGAGTATTTGAACTTCTCGAGAAGTTCAAATACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-690s1c1
Sequence:CCGGCTTCAGATTCGTTTCTGAGATCTCGAGATCTCAGAAACGAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024549.3-1648s1c1
Sequence:CCGGGATTCTTATTTCCACTGCGGTCTCGAGACCGCAGTGGAAATAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-444s1c1
Sequence:CCGGCAAACCCACCTCAAAGAGTATCTCGAGATACTCTTTGAGGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1774s1c1
Sequence:CCGGCTCAGATGCATCAGTTCCTTACTCGAGTAAGGAACTGATGCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-1769s1c1
Sequence:CCGGCAATGCTCAGATGCATCAGTTCTCGAGAACTGATGCATCTGAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024549.3-627s1c1
Sequence:CCGGCCTTCACAACCAAACTGGATACTCGAGTATCCAGTTTGGTTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024549.3-850s1c1
Sequence:CCGGCCCTATCACTGTTCAGTCCATCTCGAGATGGACTGAACAGTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039153
TCTN1 MISSION shRNA Bacterial Glycerol Stock
tectonic family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039153.2-1894s1c1
Sequence:CCGGTACCCATCCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-1328s1c1
Sequence:CCGGGAACAGACAAGGCCAATTTACCTCGAGGTAAATTGGCCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-703s1c1
Sequence:CCGGATGGCCCACAGCCCACTAAATCTCGAGATTTAGTGGGCTGTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-550s1c1
Sequence:CCGGCCGTCTTCTGCATCCATATTTCTCGAGAAATATGGATGCAGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-196s1c1
Sequence:CCGGTGACGAAGGAGGATCTCAATTCTCGAGAATTGAGATCCTCCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039153
TCTN1 MISSION shRNA shRNA Plasmid DNA
tectonic family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039153.2-1894s1c1
Sequence:CCGGTACCCATCCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-1328s1c1
Sequence:CCGGGAACAGACAAGGCCAATTTACCTCGAGGTAAATTGGCCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-703s1c1
Sequence:CCGGATGGCCCACAGCCCACTAAATCTCGAGATTTAGTGGGCTGTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-550s1c1
Sequence:CCGGCCGTCTTCTGCATCCATATTTCTCGAGAAATATGGATGCAGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-196s1c1
Sequence:CCGGTGACGAAGGAGGATCTCAATTCTCGAGAATTGAGATCCTCCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039153
TCTN1 MISSION shRNA Lentiviral Transduction Particles
tectonic family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039153.2-1894s1c1
Sequence:CCGGTACCCATCCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGGATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-1328s1c1
Sequence:CCGGGAACAGACAAGGCCAATTTACCTCGAGGTAAATTGGCCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-703s1c1
Sequence:CCGGATGGCCCACAGCCCACTAAATCTCGAGATTTAGTGGGCTGTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-550s1c1
Sequence:CCGGCCGTCTTCTGCATCCATATTTCTCGAGAAATATGGATGCAGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039153.2-196s1c1
Sequence:CCGGTGACGAAGGAGGATCTCAATTCTCGAGAATTGAGATCCTCCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks